ID: 1076947008

View in Genome Browser
Species Human (GRCh38)
Location 10:133658362-133658384
Sequence TATTGGTGACTGTGCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076947008_1076947013 25 Left 1076947008 10:133658362-133658384 CCACCTCAGCACAGTCACCAATA No data
Right 1076947013 10:133658410-133658432 CAAGTAGACACAAATCCCCATGG No data
1076947008_1076947011 -3 Left 1076947008 10:133658362-133658384 CCACCTCAGCACAGTCACCAATA No data
Right 1076947011 10:133658382-133658404 ATAGCGTAGTGAGATGAGCAAGG No data
1076947008_1076947014 26 Left 1076947008 10:133658362-133658384 CCACCTCAGCACAGTCACCAATA No data
Right 1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG No data
1076947008_1076947012 0 Left 1076947008 10:133658362-133658384 CCACCTCAGCACAGTCACCAATA No data
Right 1076947012 10:133658385-133658407 GCGTAGTGAGATGAGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076947008 Original CRISPR TATTGGTGACTGTGCTGAGG TGG (reversed) Intergenic
No off target data available for this crispr