ID: 1076947009

View in Genome Browser
Species Human (GRCh38)
Location 10:133658365-133658387
Sequence CGCTATTGGTGACTGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076947009_1076947011 -6 Left 1076947009 10:133658365-133658387 CCTCAGCACAGTCACCAATAGCG No data
Right 1076947011 10:133658382-133658404 ATAGCGTAGTGAGATGAGCAAGG No data
1076947009_1076947014 23 Left 1076947009 10:133658365-133658387 CCTCAGCACAGTCACCAATAGCG No data
Right 1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG No data
1076947009_1076947012 -3 Left 1076947009 10:133658365-133658387 CCTCAGCACAGTCACCAATAGCG No data
Right 1076947012 10:133658385-133658407 GCGTAGTGAGATGAGCAAGGAGG No data
1076947009_1076947013 22 Left 1076947009 10:133658365-133658387 CCTCAGCACAGTCACCAATAGCG No data
Right 1076947013 10:133658410-133658432 CAAGTAGACACAAATCCCCATGG No data
1076947009_1076947015 28 Left 1076947009 10:133658365-133658387 CCTCAGCACAGTCACCAATAGCG No data
Right 1076947015 10:133658416-133658438 GACACAAATCCCCATGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076947009 Original CRISPR CGCTATTGGTGACTGTGCTG AGG (reversed) Intergenic
No off target data available for this crispr