ID: 1076947010

View in Genome Browser
Species Human (GRCh38)
Location 10:133658379-133658401
Sequence TGCTCATCTCACTACGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076947010_1076947013 8 Left 1076947010 10:133658379-133658401 CCAATAGCGTAGTGAGATGAGCA No data
Right 1076947013 10:133658410-133658432 CAAGTAGACACAAATCCCCATGG No data
1076947010_1076947016 21 Left 1076947010 10:133658379-133658401 CCAATAGCGTAGTGAGATGAGCA No data
Right 1076947016 10:133658423-133658445 ATCCCCATGGGCTTGGCCTCAGG No data
1076947010_1076947014 9 Left 1076947010 10:133658379-133658401 CCAATAGCGTAGTGAGATGAGCA No data
Right 1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG No data
1076947010_1076947015 14 Left 1076947010 10:133658379-133658401 CCAATAGCGTAGTGAGATGAGCA No data
Right 1076947015 10:133658416-133658438 GACACAAATCCCCATGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076947010 Original CRISPR TGCTCATCTCACTACGCTAT TGG (reversed) Intergenic
No off target data available for this crispr