ID: 1076947014

View in Genome Browser
Species Human (GRCh38)
Location 10:133658411-133658433
Sequence AAGTAGACACAAATCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076947007_1076947014 27 Left 1076947007 10:133658361-133658383 CCCACCTCAGCACAGTCACCAAT No data
Right 1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG No data
1076947008_1076947014 26 Left 1076947008 10:133658362-133658384 CCACCTCAGCACAGTCACCAATA No data
Right 1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG No data
1076947010_1076947014 9 Left 1076947010 10:133658379-133658401 CCAATAGCGTAGTGAGATGAGCA No data
Right 1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG No data
1076947009_1076947014 23 Left 1076947009 10:133658365-133658387 CCTCAGCACAGTCACCAATAGCG No data
Right 1076947014 10:133658411-133658433 AAGTAGACACAAATCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076947014 Original CRISPR AAGTAGACACAAATCCCCAT GGG Intergenic
No off target data available for this crispr