ID: 1076947449

View in Genome Browser
Species Human (GRCh38)
Location 10:133660832-133660854
Sequence AATGGTGACCTGAGAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076947449_1076947454 30 Left 1076947449 10:133660832-133660854 CCCTCAACTCTCAGGTCACCATT No data
Right 1076947454 10:133660885-133660907 GCAGTTAACCCTGCTGAAAGTGG No data
1076947449_1076947452 -7 Left 1076947449 10:133660832-133660854 CCCTCAACTCTCAGGTCACCATT No data
Right 1076947452 10:133660848-133660870 CACCATTGGAGAAGATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076947449 Original CRISPR AATGGTGACCTGAGAGTTGA GGG (reversed) Intergenic
No off target data available for this crispr