ID: 1076958668

View in Genome Browser
Species Human (GRCh38)
Location 10:133753853-133753875
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 37, 1: 11, 2: 10, 3: 6, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076958668_1076958680 25 Left 1076958668 10:133753853-133753875 CCCACAGGGGGCTTTCGTGAGCC 0: 37
1: 11
2: 10
3: 6
4: 79
Right 1076958680 10:133753901-133753923 GCAGCCCAGCCAGGCCGCGCCGG 0: 24
1: 6
2: 16
3: 48
4: 340
1076958668_1076958677 16 Left 1076958668 10:133753853-133753875 CCCACAGGGGGCTTTCGTGAGCC 0: 37
1: 11
2: 10
3: 6
4: 79
Right 1076958677 10:133753892-133753914 CCCCGCGCTGCAGCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076958668 Original CRISPR GGCTCACGAAAGCCCCCTGT GGG (reversed) Intergenic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
904577140 1:31512193-31512215 GGCTCACGTGATCCTCCTGTTGG - Intergenic
910192016 1:84604459-84604481 GGATCACGAAATCCCCCTGTCGG - Intergenic
911330906 1:96524777-96524799 GGTTCAGGAAAGCCAACTGTGGG - Intergenic
915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG + Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
920436863 1:205952591-205952613 GGATCAGGAAAGAACCCTGTGGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG + Intergenic
1081728175 11:45347634-45347656 GCCTCACCAAAGCCCCTTGCAGG - Intergenic
1081805566 11:45888126-45888148 GGCTGAGGAGAGCCGCCTGTAGG + Intronic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1088963204 11:114691752-114691774 AGCTCACCAAAGCCCCCCTTGGG - Intronic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1118191072 14:63580877-63580899 GGCTCACTGAAGCCCTCTGATGG - Intergenic
1122799054 14:104220820-104220842 GGCCCACGACAGCTCCCTCTCGG - Intergenic
1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202849684 14_GL000225v1_random:8991-9013 GGCTCACGAAATCCCCCAGTGGG - Intergenic
1202852574 14_GL000225v1_random:30673-30695 GGATCATGAAAGCCACCTTTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202857160 14_GL000225v1_random:58698-58720 GGCACATGAAAGACCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1146138137 17:30341055-30341077 GGCTCAGGAAAGCTCCCAGCAGG - Intergenic
1151893359 17:76964099-76964121 GGCTAACGAAAGCTCCATGAGGG + Intergenic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG + Intergenic
1162819198 19:13212497-13212519 GGCTCACGAAAGCGGCCTCAAGG - Exonic
1163036515 19:14572221-14572243 GGCTCAGGGAAGTCCCCTCTCGG - Intergenic
1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG + Exonic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1165128281 19:33616486-33616508 GGGTCAGCAAAGCCCCCTGCAGG + Intergenic
928451365 2:31381357-31381379 GGCTCACCACAGCCTGCTGTTGG - Intronic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
938003320 2:127764958-127764980 GGCTCACGACAGCCCAGTGAGGG - Exonic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG + Intronic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1172025435 20:31945287-31945309 GGCTCACCACAGCCATCTGTGGG - Exonic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1183959409 22:41402273-41402295 GGCTGATGAAAGCTCCCTGAGGG - Intergenic
949596269 3:5550634-5550656 GGCTCACGAAAATCAACTGTTGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
963071978 3:141311929-141311951 GGCTCACGAACGACCCCTGGAGG - Intergenic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
969492791 4:7509603-7509625 GGTTCACCCCAGCCCCCTGTGGG - Intronic
969565822 4:7977438-7977460 GGCACACAAACGTCCCCTGTGGG + Intronic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
971562206 4:28093941-28093963 GGCTCAGGAAACCCACCTTTTGG - Intergenic
973969188 4:56194207-56194229 GGCTTACAAATGCCCGCTGTTGG - Intronic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG + Intergenic
982323117 4:154101018-154101040 GGCTCACAAAAGCCCTTTATGGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985574835 5:669259-669281 GGCTCACCAGCGCCCCCTGGGGG - Intronic
985848992 5:2374781-2374803 AGCTCAAGAAAGCCACCTATGGG + Intergenic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1002145724 5:177179649-177179671 TGCTCATGAGAGCCCCTTGTAGG - Intronic
1006120054 6:31798637-31798659 GGCTTAGGAATGCCCCCTTTTGG - Intronic
1006217731 6:32459738-32459760 TGCACACGTAAGCACCCTGTGGG - Intergenic
1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG + Intronic
1008286622 6:49660648-49660670 GGCTCAGGAAAGCTGCCTGGGGG - Intergenic
1014873482 6:126626594-126626616 GGCTTACCAAAGCCAACTGTGGG - Intergenic
1020264892 7:6553707-6553729 GGCTCCAAAAAGCCCTCTGTAGG - Intergenic
1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG + Intronic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1026523340 7:71134431-71134453 GGCTCACCAAAGGTCCCTGCTGG + Intronic
1026569625 7:71517985-71518007 AGCTCATGAAAGGCCCCTGGGGG + Intronic
1028155313 7:87422716-87422738 TGCTCAGGAAAGGCCCCTCTGGG - Intronic
1029985159 7:104916291-104916313 GGCTCAAAAAATCCTCCTGTTGG - Intergenic
1034969968 7:155412824-155412846 GGCACAGGAAAGCCCCCTAGAGG + Intergenic
1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG + Intergenic
1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG + Intronic
1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG + Intergenic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056717771 9:89046884-89046906 GTATCAAGAAAGCCCCCTGGAGG + Exonic
1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG + Intronic
1059914908 9:119088145-119088167 GGGTCTCCAAAGCACCCTGTGGG - Intergenic
1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG + Intronic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1195928067 X:110046284-110046306 GGATAAAGAAGGCCCCCTGTTGG - Intronic
1196014120 X:110919358-110919380 GGTTCAAGAAAGCCACCTCTGGG - Intergenic
1196234435 X:113262104-113262126 GGCTCAGGAGATCCCCTTGTGGG - Intergenic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic
1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG + Intergenic