ID: 1076963535

View in Genome Browser
Species Human (GRCh38)
Location 10:133786531-133786553
Sequence CAAAGGCGGCGCGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076963535_1076963543 28 Left 1076963535 10:133786531-133786553 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1076963543 10:133786582-133786604 CACACCCGGAGAGCATCGCGAGG No data
1076963535_1076963544 29 Left 1076963535 10:133786531-133786553 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1076963544 10:133786583-133786605 ACACCCGGAGAGCATCGCGAGGG No data
1076963535_1076963542 14 Left 1076963535 10:133786531-133786553 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076963535 Original CRISPR CAAAGGCGGCGCGCCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr