ID: 1076963542

View in Genome Browser
Species Human (GRCh38)
Location 10:133786568-133786590
Sequence CGTTCTCTTTAGCACACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076963541_1076963542 -3 Left 1076963541 10:133786548-133786570 CCTTTGCGAGGGCGGAGTTGCGT No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data
1076963540_1076963542 0 Left 1076963540 10:133786545-133786567 CCGCCTTTGCGAGGGCGGAGTTG No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data
1076963537_1076963542 8 Left 1076963537 10:133786537-133786559 CCGGCGCGCCGCCTTTGCGAGGG No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data
1076963531_1076963542 30 Left 1076963531 10:133786515-133786537 CCCGCGCCTCTCTGCGCCTGCGC No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data
1076963532_1076963542 29 Left 1076963532 10:133786516-133786538 CCGCGCCTCTCTGCGCCTGCGCC No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data
1076963535_1076963542 14 Left 1076963535 10:133786531-133786553 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data
1076963534_1076963542 24 Left 1076963534 10:133786521-133786543 CCTCTCTGCGCCTGCGCCGGCGC No data
Right 1076963542 10:133786568-133786590 CGTTCTCTTTAGCACACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076963542 Original CRISPR CGTTCTCTTTAGCACACACC CGG Intergenic