ID: 1076963544

View in Genome Browser
Species Human (GRCh38)
Location 10:133786583-133786605
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076963541_1076963544 12 Left 1076963541 10:133786548-133786570 CCTTTGCGAGGGCGGAGTTGCGT No data
Right 1076963544 10:133786583-133786605 ACACCCGGAGAGCATCGCGAGGG No data
1076963537_1076963544 23 Left 1076963537 10:133786537-133786559 CCGGCGCGCCGCCTTTGCGAGGG No data
Right 1076963544 10:133786583-133786605 ACACCCGGAGAGCATCGCGAGGG No data
1076963535_1076963544 29 Left 1076963535 10:133786531-133786553 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1076963544 10:133786583-133786605 ACACCCGGAGAGCATCGCGAGGG No data
1076963540_1076963544 15 Left 1076963540 10:133786545-133786567 CCGCCTTTGCGAGGGCGGAGTTG No data
Right 1076963544 10:133786583-133786605 ACACCCGGAGAGCATCGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076963544 Original CRISPR ACACCCGGAGAGCATCGCGA GGG Intergenic