ID: 1076964389

View in Genome Browser
Species Human (GRCh38)
Location 11:68933-68955
Sequence CTTTCCCCCATCGCAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076964384_1076964389 29 Left 1076964384 11:68881-68903 CCTTCACAGCCATATTGTGGAAA No data
Right 1076964389 11:68933-68955 CTTTCCCCCATCGCAGCCTCGGG No data
1076964387_1076964389 3 Left 1076964387 11:68907-68929 CCTCAGCAGTATGTGCTGGAATT No data
Right 1076964389 11:68933-68955 CTTTCCCCCATCGCAGCCTCGGG No data
1076964385_1076964389 20 Left 1076964385 11:68890-68912 CCATATTGTGGAAAACACCTCAG No data
Right 1076964389 11:68933-68955 CTTTCCCCCATCGCAGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076964389 Original CRISPR CTTTCCCCCATCGCAGCCTC GGG Intergenic
No off target data available for this crispr