ID: 1076977011

View in Genome Browser
Species Human (GRCh38)
Location 11:180917-180939
Sequence TATAGATAGCAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 6, 1: 1, 2: 14, 3: 124, 4: 880}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076977005_1076977011 28 Left 1076977005 11:180866-180888 CCCACATAAAACTGGGTAAATAT 0: 2
1: 4
2: 2
3: 26
4: 310
Right 1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG 0: 6
1: 1
2: 14
3: 124
4: 880
1076977006_1076977011 27 Left 1076977006 11:180867-180889 CCACATAAAACTGGGTAAATATC 0: 2
1: 4
2: 0
3: 19
4: 199
Right 1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG 0: 6
1: 1
2: 14
3: 124
4: 880
1076977007_1076977011 -7 Left 1076977007 11:180901-180923 CCAGCCAAATAAAATATATAGAT 0: 3
1: 3
2: 3
3: 72
4: 632
Right 1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG 0: 6
1: 1
2: 14
3: 124
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076977011 Original CRISPR TATAGATAGCAGGCCAGGTG TGG Intronic
900230735 1:1555841-1555863 TAAAAAAATCAGGCCAGGTGGGG + Intronic
900694936 1:4004006-4004028 TATTGATAGCAGGCCAGGCCAGG + Intergenic
900695325 1:4006116-4006138 TGCAGATGGCAGGCCAGGAGCGG - Intergenic
901043417 1:6379774-6379796 TAAAGAAAATAGGCCAGGTGTGG + Intronic
901184454 1:7363780-7363802 TGTGGTTAGCTGGCCAGGTGAGG + Intronic
901330073 1:8400540-8400562 TATAAATATATGGCCAGGTGAGG - Intronic
901416632 1:9121040-9121062 TAGAGAACTCAGGCCAGGTGCGG + Intronic
901431975 1:9221925-9221947 TGGAGCAAGCAGGCCAGGTGAGG - Intergenic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901609754 1:10488445-10488467 TAAAAATTTCAGGCCAGGTGCGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902190646 1:14760661-14760683 TATAAAATTCAGGCCAGGTGTGG + Intronic
902358137 1:15922902-15922924 TACATAAAGCAGACCAGGTGTGG - Intronic
902647650 1:17812781-17812803 AATAGAGAGATGGCCAGGTGTGG - Intronic
902899991 1:19508240-19508262 TTTAAAAAGTAGGCCAGGTGCGG + Intergenic
903660807 1:24977215-24977237 TTCATATAGGAGGCCAGGTGTGG + Intergenic
903753298 1:25643559-25643581 TATATATAAAAGGCCAGGCGTGG - Intronic
904173453 1:28608461-28608483 GAAAGAGAGCAGGCCGGGTGTGG + Intronic
904378765 1:30097385-30097407 GATGGATTGCAGGGCAGGTGGGG + Intergenic
904502776 1:30925665-30925687 TATATTAAGTAGGCCAGGTGCGG - Intergenic
904506006 1:30954770-30954792 AACATATAGCAGGCCAGGCGTGG + Intronic
904934556 1:34120833-34120855 TAAAGTTACCAGGCCAGGTGTGG - Intronic
905659036 1:39706510-39706532 TATACAAAATAGGCCAGGTGTGG - Intronic
906085860 1:43134222-43134244 TATAGCTAGAAGGCCACATGTGG + Intergenic
906784960 1:48607325-48607347 TCTATTGAGCAGGCCAGGTGCGG + Intronic
906986843 1:50691929-50691951 CATATCCAGCAGGCCAGGTGTGG + Intronic
906988695 1:50714059-50714081 TTTGTATATCAGGCCAGGTGCGG - Intronic
907398899 1:54212312-54212334 AATAGGTAGCAGGCCAGATTTGG + Intronic
907992696 1:59598234-59598256 TGTATATAGAAGGCCAAGTGTGG + Intronic
908472993 1:64462573-64462595 TAAAGCAGGCAGGCCAGGTGTGG - Intergenic
908506869 1:64812053-64812075 TATTGATAACAGGCCAGGCGCGG + Intronic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
908750388 1:67416969-67416991 AATAAAAAGTAGGCCAGGTGTGG + Intronic
909609899 1:77540806-77540828 TATAGAAAACTGGTCAGGTGTGG + Intronic
909698595 1:78494456-78494478 CAGAGATAGCAATCCAGGTGGGG + Intronic
909930052 1:81487352-81487374 GATATATTGAAGGCCAGGTGTGG + Intronic
910245532 1:85134511-85134533 TTTAGAGAGAAGGCCAGGTCAGG - Intergenic
910352560 1:86315454-86315476 TATATATGGCAGGCCAGGCATGG + Intergenic
910586392 1:88885146-88885168 TATAGATACCAGGCCAGGTATGG + Intronic
910833946 1:91488588-91488610 AATATATAGCTGGCCAGGTGCGG - Intergenic
910909310 1:92216987-92217009 TATAAACAAGAGGCCAGGTGTGG + Intergenic
910932358 1:92455071-92455093 TAAAAATTGCAGGCCGGGTGGGG - Intergenic
911611129 1:99960183-99960205 TATATAAAACAGGCCAGGTGAGG - Intergenic
912388467 1:109284791-109284813 TAAAGAAAGTAGGCCAGGCGCGG + Intergenic
912426313 1:109594925-109594947 TATAAATTGCCAGCCAGGTGCGG - Exonic
912811295 1:112796892-112796914 TAAAGAAAGTAGGCCGGGTGTGG + Intergenic
912929954 1:113949126-113949148 TAGCGATAACAGGCCAGGCGCGG - Intronic
913375223 1:118144021-118144043 AATAGTTAGCAGTCCAGGAGAGG - Intronic
913459682 1:119070890-119070912 AAAAGATAACAAGCCAGGTGTGG + Intronic
914806154 1:150993598-150993620 AAGAAATAACAGGCCAGGTGTGG - Intronic
914873729 1:151497102-151497124 TATTTATGCCAGGCCAGGTGCGG + Intergenic
914935890 1:151979919-151979941 TAGATAAAGCAGGCCAGGCGCGG - Intergenic
915115718 1:153598261-153598283 GATAGATCTGAGGCCAGGTGCGG + Intergenic
915302615 1:154959972-154959994 TATGGACCACAGGCCAGGTGCGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
916054845 1:161061441-161061463 TATATAAAGCAGGTCAGGCGCGG - Intronic
916242071 1:162650303-162650325 TAATAATAACAGGCCAGGTGTGG + Intronic
916550436 1:165844794-165844816 TCCAGATAGCAGAACAGGTGGGG + Intronic
916728973 1:167549671-167549693 AAAATATTGCAGGCCAGGTGCGG - Intronic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
916860134 1:168794911-168794933 GAAAGATAACAGGCCAGGTGTGG + Intergenic
917075355 1:171199178-171199200 TTTAGGTACCAGACCAGGTGGGG - Intronic
917414041 1:174789915-174789937 AATACATAACTGGCCAGGTGTGG + Intronic
918449543 1:184645286-184645308 TATTTATTGGAGGCCAGGTGCGG + Intergenic
918761973 1:188421139-188421161 GCTAGAAAGCAGGCCAGGAGTGG - Intergenic
919596397 1:199568752-199568774 TAGAAAAAGCAGGCCAGGTGTGG + Intergenic
919693404 1:200547775-200547797 TGTATATAGTAGGCCAGGCGCGG + Intergenic
919715422 1:200770702-200770724 TAGAAATAGTAGGCCAGGTGCGG - Intronic
920864369 1:209739465-209739487 AATAGATAGGAGGCCAAGCGAGG - Intergenic
921394506 1:214654280-214654302 TATATATACTGGGCCAGGTGTGG + Intronic
921484224 1:215697247-215697269 AATAGGGGGCAGGCCAGGTGAGG - Intronic
921850994 1:219931769-219931791 TATAAAATGCTGGCCAGGTGTGG - Intronic
922281583 1:224130049-224130071 TACATACAGCAGGCCAGCTGTGG + Intronic
922313683 1:224421637-224421659 AACATCTAGCAGGCCAGGTGTGG + Intronic
922713668 1:227853330-227853352 TAGACAGAGCAGGCCAGGTGTGG - Intergenic
923175799 1:231463725-231463747 TACAGCTAATAGGCCAGGTGAGG + Intergenic
923521306 1:234737113-234737135 AATGTATATCAGGCCAGGTGTGG - Intergenic
924156484 1:241181980-241182002 GATAGAGAGCAGGCCAGGAATGG - Intronic
924326803 1:242903285-242903307 AAAAGAAATCAGGCCAGGTGCGG + Intergenic
924473554 1:244364393-244364415 AATAAAAAGCAGGCCGGGTGTGG - Intronic
924591779 1:245410724-245410746 AAAAGAAAGAAGGCCAGGTGGGG - Intronic
924598983 1:245471422-245471444 CATAACTATCAGGCCAGGTGTGG - Intronic
924845604 1:247767007-247767029 GATACATAACAGGTCAGGTGCGG - Intergenic
1063001707 10:1930803-1930825 TAAAAAAATCAGGCCAGGTGTGG + Intergenic
1063024473 10:2164382-2164404 TCAAGAAATCAGGCCAGGTGAGG + Intergenic
1063405036 10:5785664-5785686 TAAAGGTAGTGGGCCAGGTGTGG - Intronic
1063536842 10:6891716-6891738 TGTAGGGAGAAGGCCAGGTGAGG - Intergenic
1064183739 10:13142281-13142303 TATTGAAACTAGGCCAGGTGCGG + Intergenic
1064444009 10:15377643-15377665 AAAAGATAGTAGGCCAGGTCTGG - Intergenic
1064627310 10:17274266-17274288 AAGAGATAATAGGCCAGGTGCGG - Intergenic
1064663151 10:17626432-17626454 ATTAGAAAACAGGCCAGGTGCGG - Intergenic
1064765599 10:18667990-18668012 TATATTTAGAAGGCCAGGTGTGG - Intronic
1064803446 10:19103269-19103291 TTTAGAGAACCGGCCAGGTGCGG + Intronic
1065094118 10:22263818-22263840 TTTAAAAAGCAGCCCAGGTGTGG - Intergenic
1065781102 10:29168541-29168563 TATCTAAATCAGGCCAGGTGTGG + Intergenic
1065984248 10:30933810-30933832 TATAGAAAGCAGGCACAGTGGGG + Intronic
1066409874 10:35157338-35157360 TAAGGATACCAGGCCAGGTGTGG + Intronic
1066605695 10:37168170-37168192 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1066606478 10:37179962-37179984 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1066607252 10:37191703-37191725 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1067001617 10:42619921-42619943 TATAAAAATCAGGCCAGGTGTGG + Intronic
1067241292 10:44497037-44497059 TAGAGATACCAGGGCAGGTAGGG + Intergenic
1067944507 10:50681719-50681741 GACAGATGGCAGGACAGGTGTGG + Intergenic
1068223770 10:54079330-54079352 TTCAGATGGCAGGCCAGATGGGG - Exonic
1068342913 10:55732309-55732331 TTTATATATGAGGCCAGGTGCGG - Intergenic
1068475173 10:57515227-57515249 TATATAAAAGAGGCCAGGTGCGG - Intergenic
1068941835 10:62688228-62688250 TATAGTTTGCAGGCCAGGCACGG + Intergenic
1069033290 10:63620221-63620243 TATAAACTGCTGGCCAGGTGAGG - Intronic
1069827872 10:71265406-71265428 TAGACAGGGCAGGCCAGGTGGGG - Intronic
1069960830 10:72078223-72078245 TATAAATAATAGGCCAGGCGCGG + Intronic
1070099368 10:73370262-73370284 TAAAGATATAAGGCCAGGTGTGG + Intergenic
1070188748 10:74092195-74092217 TAAAAATAATAGGCCAGGTGTGG - Intronic
1070879800 10:79846721-79846743 GACAGATGGCAGGACAGGTGTGG + Intronic
1070898027 10:80002203-80002225 TTTAAAAATCAGGCCAGGTGTGG + Intergenic
1071330321 10:84552474-84552496 CATAGTTAGAAGGCAAGGTGAGG - Intergenic
1071632907 10:87230811-87230833 GACAGATGGCAGGACAGGTGTGG + Intronic
1071646356 10:87363029-87363051 GACAGATGGCAGGACAGGTGTGG + Intronic
1071688047 10:87783087-87783109 TATAGCTAATAGGCCAGGTGTGG + Intronic
1072088781 10:92106522-92106544 TTGAGATGGGAGGCCAGGTGCGG + Intronic
1072149340 10:92673111-92673133 TATGGACAGTAGGCCAGGCGCGG - Intergenic
1072499381 10:95997676-95997698 TTTAAGAAGCAGGCCAGGTGTGG - Intronic
1072545791 10:96436974-96436996 AATGTATAGCAGGCCAGGTGCGG - Intronic
1072550904 10:96476550-96476572 TAAAAATCACAGGCCAGGTGCGG - Intronic
1072596841 10:96880686-96880708 GACAGATAACTGGCCAGGTGTGG - Intronic
1073142251 10:101255885-101255907 AAAAGAAAGAAGGCCAGGTGCGG - Intergenic
1073168299 10:101477938-101477960 TAGAAAAATCAGGCCAGGTGCGG - Intronic
1073253409 10:102135667-102135689 TATAGCTTACAGGCCGGGTGTGG - Intronic
1073264346 10:102215975-102215997 TAAAGAGAATAGGCCAGGTGCGG - Intergenic
1073463528 10:103680267-103680289 TAAAGAAGGCAGGCCGGGTGTGG - Intronic
1073796665 10:106995936-106995958 TGTAGAAATGAGGCCAGGTGCGG + Intronic
1073986402 10:109214791-109214813 TAAAGAAAGTAGGCCGGGTGTGG + Intergenic
1075176697 10:120170573-120170595 TAAAGATGAAAGGCCAGGTGCGG - Intergenic
1075185757 10:120255431-120255453 TAGAGATAATAGGCCAGGCGTGG + Intergenic
1075325675 10:121530330-121530352 AAGAGTTGGCAGGCCAGGTGCGG + Intronic
1075555111 10:123425023-123425045 TAGAGACAGCAGACCAGGGGTGG - Intergenic
1075582135 10:123627770-123627792 CAAAAAAAGCAGGCCAGGTGTGG - Intergenic
1075610154 10:123847232-123847254 TGAAGATTTCAGGCCAGGTGCGG + Intronic
1075997588 10:126891183-126891205 TATAGATGGCCCCCCAGGTGTGG + Intergenic
1076295915 10:129384299-129384321 TATATATTTCAGGCCAGGTGTGG + Intergenic
1076689499 10:132214870-132214892 TATAATTAACAGGCCAGGAGAGG + Intronic
1076800236 10:132818560-132818582 GAGAAATAACAGGCCAGGTGCGG + Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1077626620 11:3777906-3777928 TACTGATGGCAGGCCAGGCGCGG + Intronic
1078219455 11:9339481-9339503 AATAAACAGCAGGCCAGGTGCGG + Intergenic
1078875375 11:15389497-15389519 TCGAGAAAGCAGGCCAGGCGTGG - Intergenic
1081009940 11:37798273-37798295 TATAGATGGCCCCCCAGGTGTGG - Intergenic
1081536497 11:44000412-44000434 TAGAGACAGGGGGCCAGGTGAGG - Intergenic
1081547994 11:44085446-44085468 AAAATAGAGCAGGCCAGGTGAGG - Intergenic
1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG + Intergenic
1082020345 11:47527803-47527825 AACACAAAGCAGGCCAGGTGTGG + Intronic
1082045193 11:47720276-47720298 TCTATAAAGCAGGCCAGGCGCGG + Intronic
1082184252 11:49160730-49160752 TAGAAATATCTGGCCAGGTGTGG - Intronic
1083709308 11:64538486-64538508 TAAAGAAAGCCGGCCAGGCGCGG - Intergenic
1084114700 11:67035288-67035310 GTTAAAAAGCAGGCCAGGTGTGG - Intronic
1084139032 11:67211321-67211343 TATAGAAAATAAGCCAGGTGCGG + Intronic
1084297586 11:68222879-68222901 TAAAAATAACAGGCCAGGCGAGG + Intergenic
1084307343 11:68295679-68295701 AATAAATTCCAGGCCAGGTGTGG + Intergenic
1084522625 11:69673841-69673863 AGTGGATTGCAGGCCAGGTGCGG - Intronic
1084782522 11:71419738-71419760 TATTGAAACAAGGCCAGGTGAGG - Intergenic
1085078206 11:73610925-73610947 AAAAAATAGAAGGCCAGGTGAGG - Intergenic
1085985953 11:81788590-81788612 AATAGACAGCAGGCCGGGCGCGG - Intergenic
1086093331 11:83025896-83025918 TATAGATACAAGGCCAGGCATGG + Intronic
1086135408 11:83439096-83439118 TAGAGGTAGAAGGCCAGGTGCGG - Intergenic
1086357942 11:86025109-86025131 AAAAAATAGCAGGCCGGGTGTGG + Intronic
1086399300 11:86447553-86447575 TAGAGAGACCAGGCCAGGTGTGG + Intronic
1086408098 11:86516679-86516701 TATAGATATTAGGCCAGGCACGG - Intronic
1086617244 11:88836507-88836529 TCTAGAAAACAGGCCAGGCGCGG + Intronic
1086682094 11:89684649-89684671 TAGAAATATCTGGCCAGGTGTGG + Intergenic
1087164230 11:94984563-94984585 TAAAAATAGCAGGCCAGGCATGG + Intronic
1087177597 11:95109707-95109729 AGCAGGTAGCAGGCCAGGTGTGG - Intronic
1087295481 11:96368108-96368130 AATAAATTCCAGGCCAGGTGTGG - Intronic
1088244513 11:107804124-107804146 CTTAGATTGCAGGCCTGGTGCGG - Intronic
1088670136 11:112132584-112132606 GCTAGCTAGCAGGCCAGGTGCGG - Intronic
1088934926 11:114390119-114390141 CAAAGATTGTAGGCCAGGTGTGG - Intergenic
1089245592 11:117117158-117117180 AATAGGTGGCAGGCCGGGTGTGG + Intergenic
1090370001 11:126243611-126243633 TCTGCATATCAGGCCAGGTGCGG + Intronic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1090389530 11:126379766-126379788 TAAGGATAACAGGCCGGGTGTGG - Intronic
1090866687 11:130707102-130707124 TAGAGAAAGAAGCCCAGGTGGGG - Intronic
1090877199 11:130801294-130801316 TACAGAATCCAGGCCAGGTGCGG - Intergenic
1091418341 12:311351-311373 CACAGTTAGCAGGCCAGGCGTGG + Intronic
1091479203 12:809052-809074 GAGAGATAGGAGGCCAGGTGCGG - Intronic
1092130393 12:6108001-6108023 TATACAAAGCAGGCCAGGCACGG + Intronic
1092291916 12:7164686-7164708 AATAAATAACAGGCCAGGCGCGG - Intergenic
1092346831 12:7722288-7722310 CATATAGATCAGGCCAGGTGAGG - Intergenic
1092369435 12:7904337-7904359 TGTTAATAGCAGGCCGGGTGCGG - Intergenic
1094098720 12:26737541-26737563 AATAGAAGGTAGGCCAGGTGCGG - Intronic
1094128556 12:27050179-27050201 AAAAATTAGCAGGCCAGGTGTGG - Intronic
1094204610 12:27827066-27827088 GAATGATATCAGGCCAGGTGTGG - Intergenic
1094213695 12:27919027-27919049 TAAAAATAGCCGGCCAGGTGCGG + Intergenic
1094632666 12:32192139-32192161 AAGATAAAGCAGGCCAGGTGCGG + Intronic
1095753286 12:45734076-45734098 TAAAAATTGGAGGCCAGGTGCGG + Intronic
1096084995 12:48859594-48859616 TGCAGATTCCAGGCCAGGTGTGG + Intronic
1096322027 12:50623094-50623116 TATATAAAACAGGCCAGGTGTGG + Intronic
1096641548 12:52998597-52998619 TCTGGTTAGCAGGCCAGGTGCGG - Intergenic
1096768135 12:53911165-53911187 AATAATGAGCAGGCCAGGTGCGG - Intergenic
1097292626 12:57931796-57931818 TAGTGCCAGCAGGCCAGGTGCGG + Intergenic
1098829458 12:75342031-75342053 TATAAATAGGTGGCCAGGCGTGG - Intronic
1099346506 12:81506893-81506915 AACAGGTAGCAGGCCAGATGTGG + Intronic
1099384892 12:82002437-82002459 TATCAACATCAGGCCAGGTGCGG + Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100292747 12:93233476-93233498 TATGGGTAGTAGGCCAGGCGTGG + Intergenic
1100355155 12:93821825-93821847 TGTAGACAGCAGGCCAGGTGTGG + Intronic
1100362024 12:93888133-93888155 TAGAGATGGCAGGCCGGGCGCGG + Intronic
1100386236 12:94106613-94106635 TTTAGATAGAATGGCAGGTGAGG - Intergenic
1100681816 12:96932314-96932336 TATAATTTGGAGGCCAGGTGCGG + Intronic
1100920218 12:99476100-99476122 TAAAAATTGAAGGCCAGGTGCGG + Intronic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101209365 12:102520859-102520881 TTGAGATATCAGTCCAGGTGTGG + Intergenic
1101312169 12:103591192-103591214 TATATATTGTTGGCCAGGTGTGG + Intronic
1101322185 12:103682315-103682337 TACAGAAATCAGGCCAGGGGAGG + Intronic
1101333468 12:103776263-103776285 TGAAAAAAGCAGGCCAGGTGCGG + Exonic
1101701965 12:107182627-107182649 AATAAATATAAGGCCAGGTGCGG + Intergenic
1103142040 12:118557106-118557128 AATAAATAACAGGCCAGGCGCGG - Intergenic
1103498999 12:121386043-121386065 TATTAAAAGTAGGCCAGGTGCGG - Intronic
1103620503 12:122184382-122184404 TCTAGAGAGTAGGCCAGGTGCGG - Intronic
1103699973 12:122844127-122844149 TAAAAATAATAGGCCAGGTGTGG - Intronic
1103786018 12:123433700-123433722 TATACAAACCAGGCCAGGCGCGG - Intronic
1103788758 12:123454150-123454172 AATAAATATCAGGCCAGGTGCGG - Intergenic
1103870697 12:124089272-124089294 TACTTATTGCAGGCCAGGTGTGG - Intronic
1104010796 12:124928706-124928728 TACAATTAACAGGCCAGGTGCGG + Intergenic
1104131624 12:125899305-125899327 AAAAGATAATAGGCCAGGTGCGG - Intergenic
1104984583 12:132589483-132589505 CTTAGCCAGCAGGCCAGGTGCGG - Intergenic
1105018440 12:132800668-132800690 AAAAAATAACAGGCCAGGTGCGG + Intronic
1105050374 12:133044623-133044645 TATAGCTATTTGGCCAGGTGTGG + Intronic
1105297569 13:19102805-19102827 TAAAGACAGCAGGCCGGGTGTGG + Intergenic
1105366890 13:19773526-19773548 TATAAAAAACAGGCCGGGTGCGG - Intronic
1105707664 13:22978290-22978312 TATAAAACGCCGGCCAGGTGAGG - Intergenic
1105741318 13:23326675-23326697 TAAAGATAGTGGTCCAGGTGCGG + Intergenic
1106273368 13:28176714-28176736 TTTAGATTCCAGGCCAGGTGTGG + Intronic
1106464781 13:30003387-30003409 TATACATAACAGGCTGGGTGCGG - Intergenic
1106994308 13:35463330-35463352 AATAAGTTGCAGGCCAGGTGCGG + Intronic
1107407489 13:40128130-40128152 TAAACGTAGCAGGCCAGGAGAGG - Intergenic
1107585367 13:41841494-41841516 TATAAACAGTAGGCCGGGTGCGG + Intronic
1107670363 13:42740113-42740135 AATAAATATAAGGCCAGGTGTGG + Intergenic
1108232854 13:48368713-48368735 TATATATTGAAGGCCAGGTGTGG + Intronic
1108349038 13:49573738-49573760 AATACAAAGAAGGCCAGGTGCGG - Intronic
1108349086 13:49574072-49574094 AATACAAAGAAGGCCAGGTGTGG - Intronic
1108616596 13:52139606-52139628 AACAAAAAGCAGGCCAGGTGTGG + Intronic
1108755366 13:53495048-53495070 TAGGCATTGCAGGCCAGGTGTGG + Intergenic
1108912394 13:55571993-55572015 TATAAAGAGCAGGCCAGCTAAGG + Intergenic
1109072708 13:57788845-57788867 TAAAGATACTAGGCCAGGTGCGG - Intergenic
1109220828 13:59639377-59639399 AACAGACAGTAGGCCAGGTGCGG + Intergenic
1109252102 13:60032013-60032035 TAATGACTGCAGGCCAGGTGCGG - Intronic
1109684145 13:65791382-65791404 TTCAAATAGCAGGCCAGGCGCGG + Intergenic
1109713953 13:66196048-66196070 TATGAACATCAGGCCAGGTGTGG - Intergenic
1110398322 13:75059273-75059295 TCAAAATACCAGGCCAGGTGTGG + Intergenic
1111290138 13:86155821-86155843 TATAAATAATACGCCAGGTGTGG + Intergenic
1111416399 13:87950961-87950983 AATAGATTATAGGCCAGGTGTGG - Intergenic
1112029197 13:95441529-95441551 TATTCATGGCAGGCCAGGTGTGG - Intronic
1112273951 13:97998263-97998285 CATAGATACTTGGCCAGGTGCGG - Intronic
1112315086 13:98353666-98353688 TACAAAAAGCAGGCCGGGTGTGG - Intronic
1112380781 13:98887324-98887346 TATGGATAATAGGCCGGGTGGGG + Intronic
1112552190 13:100431897-100431919 TACAGATACCAGGCCGGGTGTGG + Intronic
1112893235 13:104264935-104264957 AATAGATAACAGGGAAGGTGTGG - Intergenic
1113121488 13:106928116-106928138 TAAACATTGCTGGCCAGGTGTGG - Intergenic
1113605366 13:111600841-111600863 TATTCATGGCAGGCCAGGAGTGG + Intronic
1114163382 14:20193533-20193555 AATAGGCAGCAGGCCAGGTTTGG - Intergenic
1114305730 14:21421049-21421071 TACATATATGAGGCCAGGTGCGG - Intronic
1114501670 14:23173929-23173951 TAAACAAAGCTGGCCAGGTGGGG - Intronic
1114509298 14:23243784-23243806 TATAAATAACAGGCCAGCTGAGG + Intronic
1115060305 14:29180277-29180299 TAAAGATTGCCGGCCAGGCGCGG + Intergenic
1115133386 14:30080147-30080169 TACATATAGCAGGCTGGGTGCGG + Intronic
1115203979 14:30881666-30881688 TATTAATTGCTGGCCAGGTGCGG + Intronic
1115863420 14:37714885-37714907 TATTGAGGGCTGGCCAGGTGTGG + Intronic
1116411212 14:44625998-44626020 TTTATAAAACAGGCCAGGTGGGG - Intergenic
1116831658 14:49726139-49726161 TCCAAATAACAGGCCAGGTGTGG - Intronic
1116989694 14:51262300-51262322 TATATATATAAGGCTAGGTGTGG - Intergenic
1117017861 14:51536705-51536727 TATGGACAAGAGGCCAGGTGCGG - Intronic
1117129254 14:52668253-52668275 TATAAACAGCAGGCCAGGCATGG + Intronic
1117236274 14:53780355-53780377 TATAGCTAGCAGCCCTGGTGAGG - Intergenic
1117516522 14:56507406-56507428 TATCTATATTAGGCCAGGTGTGG + Intronic
1117734483 14:58755068-58755090 TATAGATATAAGGCCAGGTGGGG - Intergenic
1118026684 14:61775542-61775564 TATAGAGGGTAGGCCAGGTGTGG - Intronic
1118358228 14:65033565-65033587 TAAAAAAAGCAGGCCAGGTGCGG + Intronic
1118542105 14:66839986-66840008 TATTGAAAGCAGGCCAGTTGTGG + Intronic
1118586132 14:67355100-67355122 TAAAAAATGCAGGCCAGGTGCGG - Intronic
1118985462 14:70750775-70750797 TAATGATAACAGGCCAGGTGTGG - Intronic
1119030626 14:71189402-71189424 AAGAGAGAGGAGGCCAGGTGTGG - Intergenic
1119036462 14:71233786-71233808 TATGAATAACAGGCCGGGTGTGG + Intergenic
1119238917 14:73042736-73042758 AAAAGAAAACAGGCCAGGTGTGG + Intergenic
1119276793 14:73364208-73364230 AATATATAGCAGGCCAGGCATGG + Intronic
1119644504 14:76338653-76338675 AGAAAATAGCAGGCCAGGTGTGG + Intronic
1119784980 14:77306252-77306274 TATAGTTAGCAGCCCTGGCGTGG - Intronic
1120315755 14:82890575-82890597 TATATAGAGGAGGCCAGGCGTGG - Intergenic
1121055794 14:90851326-90851348 TATCTTTACCAGGCCAGGTGCGG - Exonic
1121450250 14:94002442-94002464 GATACAGAACAGGCCAGGTGTGG - Intergenic
1121873755 14:97432450-97432472 TAAAGACAGTAGGCCAGGCGTGG - Intergenic
1122220208 14:100233676-100233698 TATAGTTAGGAGGCTGGGTGCGG + Intergenic
1122332135 14:100927797-100927819 AATTGAAAGAAGGCCAGGTGTGG + Intergenic
1122763370 14:104046934-104046956 GAAAAAGAGCAGGCCAGGTGCGG - Intronic
1123415563 15:20092447-20092469 TAAAAATTGCAGACCAGGTGTGG + Intergenic
1123435654 15:20252196-20252218 GAAAGATAGGAGGCCAGGTGCGG + Intergenic
1123524902 15:21099561-21099583 TAAAAATTGCAGACCAGGTGTGG + Intergenic
1124234672 15:27978975-27978997 TAAAGATACAAGGCCAGGCGCGG - Intronic
1124343585 15:28905679-28905701 CAGAGATATCAAGCCAGGTGCGG - Intronic
1124558348 15:30747997-30748019 TACATCTAGAAGGCCAGGTGTGG + Intronic
1124829550 15:33134709-33134731 TAAAAATGGAAGGCCAGGTGCGG + Intronic
1124894670 15:33765340-33765362 AATAGTTAGGAGGCCAGGCGCGG + Intronic
1124928552 15:34096695-34096717 TAAAAATGGCAGGCCAGGCGTGG + Intronic
1125366031 15:38917096-38917118 AATAGAAAGTAGGCCGGGTGCGG - Intergenic
1125795075 15:42398055-42398077 AAAAAATAGAAGGCCAGGTGTGG - Intronic
1125961541 15:43833923-43833945 TATAAATGGCAGGCCGGGTGTGG - Intronic
1126116010 15:45208216-45208238 AAGAAAGAGCAGGCCAGGTGAGG - Intergenic
1126615705 15:50577257-50577279 TAGAAAAATCAGGCCAGGTGCGG + Intronic
1126633528 15:50760547-50760569 AAAAGACATCAGGCCAGGTGTGG - Intronic
1126806032 15:52350220-52350242 AATAAATCACAGGCCAGGTGTGG - Intronic
1126822636 15:52520018-52520040 AATAGAAGCCAGGCCAGGTGCGG - Intronic
1126838670 15:52694453-52694475 TATACTCAGCAGGCCGGGTGCGG - Intronic
1127098404 15:55536137-55536159 GAAATATAGCAGGCCGGGTGCGG - Intergenic
1127229765 15:56977240-56977262 TTTAAATAAAAGGCCAGGTGTGG + Intronic
1127503065 15:59572614-59572636 TGTAAATATCTGGCCAGGTGTGG + Intergenic
1127670460 15:61189565-61189587 AACAGATATCTGGCCAGGTGTGG + Intronic
1128380951 15:67112075-67112097 TACAAATGGAAGGCCAGGTGCGG - Intronic
1128427435 15:67556074-67556096 TACAAATAGCTGGCCAGGTACGG - Intronic
1128467025 15:67921375-67921397 TTTAGGAGGCAGGCCAGGTGTGG + Intergenic
1128950137 15:71871082-71871104 TAAACATACTAGGCCAGGTGTGG + Intronic
1129039518 15:72674097-72674119 AATAGAAATCAGGCCAGGTGCGG + Intergenic
1129218814 15:74118945-74118967 TAATAAAAGCAGGCCAGGTGCGG - Intronic
1130066870 15:80612161-80612183 TAAAGACTCCAGGCCAGGTGTGG + Intergenic
1130834588 15:87637009-87637031 GATACAGAGCAGGCCAAGTGTGG + Intergenic
1130951138 15:88589485-88589507 TACAAATAGGGGGCCAGGTGTGG + Intergenic
1131088402 15:89598652-89598674 TAAAGGTAGGAGGCCAGGCGTGG - Intronic
1131238849 15:90720872-90720894 TGAAAAAAGCAGGCCAGGTGCGG - Intronic
1131370342 15:91875779-91875801 AGTAGAGAGCAGGCCAGGTTTGG - Intronic
1131573591 15:93564221-93564243 TAAAAATAACAAGCCAGGTGTGG - Intergenic
1132239510 15:100247175-100247197 TATAGTCTTCAGGCCAGGTGTGG - Intronic
1132330628 15:101009874-101009896 AAAAGAAATCAGGCCAGGTGCGG - Intronic
1132772198 16:1569938-1569960 TAAATAAAGCAGGCCAGATGCGG - Intronic
1132821671 16:1875697-1875719 AATAGATTGTAGGCCAGGCGTGG + Intronic
1132898798 16:2242281-2242303 TATGGACAGTGGGCCAGGTGCGG - Intronic
1132920364 16:2386458-2386480 AATAGAAAGTAGGCCAGGCGCGG - Intergenic
1133096084 16:3446899-3446921 TGCAGTGAGCAGGCCAGGTGCGG - Intronic
1133908636 16:10044320-10044342 AAAATATTGCAGGCCAGGTGTGG - Intronic
1134244247 16:12528113-12528135 AATAAATAACAGGCCAGGTGCGG - Intronic
1134507118 16:14817005-14817027 TATATATATCAGGCCGGGCGCGG - Intronic
1134694818 16:16215762-16215784 TATATATATCAGGCCGGGCGCGG - Intronic
1134902785 16:17953682-17953704 TACAGATTCCTGGCCAGGTGTGG + Intergenic
1134907832 16:17996429-17996451 AATAGATAGCAAGCCAGATTTGG + Intergenic
1135082434 16:19447842-19447864 TAGGGATAACAGGCTAGGTGTGG - Intronic
1135432628 16:22399181-22399203 AATAAATTGCTGGCCAGGTGTGG - Intronic
1136228677 16:28874786-28874808 TTCAGATCACAGGCCAGGTGTGG + Intergenic
1136252983 16:29018823-29018845 AATAAATCGTAGGCCAGGTGAGG - Intergenic
1136459634 16:30401580-30401602 TTTAGAAAGCAGGCCAGGCACGG - Intergenic
1136848950 16:33598799-33598821 GAAAGATAGGAGGCCAGGTGTGG - Intergenic
1137615275 16:49842454-49842476 TAAACATAAAAGGCCAGGTGTGG + Intronic
1137885045 16:52094015-52094037 AATAGATATGAGGCCAGGTGCGG - Intergenic
1138161950 16:54762789-54762811 TAAAGAAATCAGGCCAGGCGTGG - Intergenic
1138441853 16:57040078-57040100 TATAGACAGCAGGCCAGGGCAGG + Intronic
1138724703 16:59123235-59123257 TATATATTGCAGGCCAGGAGTGG - Intergenic
1138957264 16:61986212-61986234 TACAGATATTTGGCCAGGTGTGG - Intronic
1139069149 16:63358954-63358976 GTTAAATATCAGGCCAGGTGCGG + Intergenic
1139428465 16:66897969-66897991 AATAGAAACAAGGCCAGGTGTGG + Intergenic
1139568372 16:67794455-67794477 AATACACAGCAGGCCGGGTGTGG - Intronic
1139777117 16:69323443-69323465 TATAAAATGCAGGCTAGGTGTGG - Intronic
1140170631 16:72600299-72600321 AATATATAGATGGCCAGGTGTGG + Intergenic
1140226249 16:73079627-73079649 TAAAGATAGGAGGCCAGGTGTGG - Intergenic
1140457534 16:75113880-75113902 GGGAGATGGCAGGCCAGGTGAGG + Intronic
1140606998 16:76551117-76551139 TAGATATAACTGGCCAGGTGCGG + Intronic
1140754281 16:78053577-78053599 AATAGAAAGCAGGCCAGGTGTGG - Intronic
1140768098 16:78178573-78178595 AATAGATAGCAGGCCAGGTGCGG + Intronic
1141200947 16:81897138-81897160 AATAGATGGCAGGCCAGATTTGG + Intronic
1141784180 16:86187520-86187542 GGCAGATGGCAGGCCAGGTGTGG + Intergenic
1142243255 16:88956663-88956685 AACAGACACCAGGCCAGGTGGGG - Intronic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1203110657 16_KI270728v1_random:1447449-1447471 GAAAGATAGGAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142660585 17:1426399-1426421 AATTGCTGGCAGGCCAGGTGTGG - Intronic
1142861429 17:2764430-2764452 TAAAAATAGAAGGCCAGGCGCGG + Intergenic
1142923220 17:3209330-3209352 TAAATATTGCAGGCCAGGTGTGG + Intergenic
1143000575 17:3792405-3792427 TATAGATATCAGGCCGGGCGCGG - Intronic
1143341589 17:6215472-6215494 TATAGAGAGCAGAGGAGGTGAGG + Intergenic
1143507489 17:7375988-7376010 TAAACATACCTGGCCAGGTGCGG + Intergenic
1143696735 17:8626273-8626295 AAAAGAAAGGAGGCCAGGTGGGG + Intronic
1143817101 17:9525764-9525786 CAGAGATAGCAGGCCATGTGGGG - Intronic
1145106841 17:20124888-20124910 TAAAAATTGCAGGCCAGGCGCGG + Intronic
1145718589 17:27047130-27047152 TTTAAAGAGCTGGCCAGGTGCGG + Intergenic
1145867879 17:28252384-28252406 TAGAAAGTGCAGGCCAGGTGTGG - Intergenic
1146042415 17:29468837-29468859 TAAAGATCACAGGCTAGGTGCGG - Intronic
1146186183 17:30725839-30725861 TAATAATAGCAGGCCAGGTGTGG + Intergenic
1146204635 17:30891995-30892017 TATTAATTTCAGGCCAGGTGAGG - Intronic
1146384684 17:32359399-32359421 TATAAAAACTAGGCCAGGTGTGG - Intronic
1146387931 17:32394114-32394136 AAAAGAAAGCAGGCCAGGCGCGG + Intergenic
1146550971 17:33780259-33780281 CATAGCTTCCAGGCCAGGTGTGG - Intronic
1146666157 17:34705321-34705343 TTAAGATATCTGGCCAGGTGTGG + Intergenic
1147589495 17:41672706-41672728 TTTAAAGAGCTGGCCAGGTGAGG - Intergenic
1147722964 17:42550049-42550071 AACAGATAGGAGGCTAGGTGAGG + Exonic
1147724176 17:42556276-42556298 AACAGATAGGAGGCTAGGTGAGG + Intergenic
1147730026 17:42593898-42593920 TATAGAGCCCTGGCCAGGTGTGG + Intronic
1147924238 17:43936847-43936869 TAGAAAGTGCAGGCCAGGTGTGG + Intergenic
1148605283 17:48924553-48924575 TGTAGATAGACAGCCAGGTGCGG + Intronic
1148791137 17:50173638-50173660 TAGAGACAGCTGGGCAGGTGAGG - Intronic
1148914708 17:50965987-50966009 TATAGAAAGCAATCCAGATGTGG - Exonic
1149474101 17:56944725-56944747 AATAAACAGAAGGCCAGGTGCGG + Intronic
1149710278 17:58735485-58735507 TATAGAAATGAGGCCAGGTGTGG - Exonic
1149786363 17:59438793-59438815 TACAGTTAAGAGGCCAGGTGTGG - Intergenic
1149882922 17:60310743-60310765 TAAATCAAGCAGGCCAGGTGTGG + Intronic
1149897705 17:60441866-60441888 TAAATATGGCAGGCCAGGCGTGG - Intergenic
1150270485 17:63861306-63861328 TAGAGAAAATAGGCCAGGTGCGG + Intergenic
1150524052 17:65903086-65903108 TATAGTTTGCAGGCCAGGTAGGG - Intronic
1151452718 17:74208643-74208665 AAAAGATAATAGGCCAGGTGCGG + Intronic
1151562374 17:74877621-74877643 TATAAATAGCCAGCCAGGGGCGG - Exonic
1151788003 17:76285420-76285442 TACAGAAAATAGGCCAGGTGTGG - Intronic
1152014773 17:77743351-77743373 ACTTGAGAGCAGGCCAGGTGTGG + Intergenic
1152208328 17:78988782-78988804 TTAAGAAAGTAGGCCAGGTGCGG - Intergenic
1152266702 17:79299118-79299140 AATAAATAAGAGGCCAGGTGTGG + Intronic
1152872962 17:82768036-82768058 TAAAGAAAAAAGGCCAGGTGTGG - Intronic
1153126887 18:1803856-1803878 TATAAACTGCAGGCCAGGTGTGG - Intergenic
1153171454 18:2320660-2320682 AATAGATAACATGTCAGGTGAGG + Intergenic
1153323526 18:3795602-3795624 AATAGAAAACAGGCCAGGCGCGG - Intronic
1153767070 18:8385011-8385033 TATAGCCAGCAGGCAGGGTGGGG + Intronic
1153956201 18:10098463-10098485 TAAAGAGAGTAGGCCAGATGTGG - Intergenic
1154091100 18:11364116-11364138 AGAAGATAGAAGGCCAGGTGCGG - Intergenic
1154130827 18:11735594-11735616 TATAAAAAGTTGGCCAGGTGTGG + Intronic
1154208593 18:12359446-12359468 TAAAGATAAAAAGCCAGGTGTGG + Intronic
1154478590 18:14793602-14793624 TAAAGATTTCAGGCCAGGCGTGG + Intronic
1154479540 18:14805928-14805950 TAAAGATTTCAGGCCAGGCGTGG + Intronic
1155136186 18:22995015-22995037 TAAAGATAGCAGGCTGGGCGTGG - Intronic
1156273374 18:35557866-35557888 AATAGATCAGAGGCCAGGTGAGG - Intergenic
1157552786 18:48592976-48592998 TATAGACACCAGCCCAGCTGTGG - Intronic
1157868335 18:51205931-51205953 TATGGAAAAAAGGCCAGGTGCGG + Intronic
1157895273 18:51460563-51460585 TTAAAATAACAGGCCAGGTGTGG - Intergenic
1158590537 18:58775110-58775132 GAAAGAAGGCAGGCCAGGTGCGG + Intergenic
1158650659 18:59281767-59281789 AATTGAAAGCAGGTCAGGTGCGG - Intronic
1158720202 18:59917875-59917897 TAGAGACAGGAGGCCAGGTGCGG + Intergenic
1158784353 18:60691490-60691512 TATGGATAGCAGGCAACTTGGGG + Intergenic
1158790710 18:60777376-60777398 TATAAAAAACTGGCCAGGTGTGG + Intergenic
1158941866 18:62412074-62412096 TAGAGATGGGAGGCCAGGCGTGG - Intergenic
1158947772 18:62462512-62462534 AAGAAATAGGAGGCCAGGTGTGG - Intergenic
1158985303 18:62809408-62809430 AAAAGGTAACAGGCCAGGTGCGG + Intronic
1159038664 18:63302031-63302053 AAAAGAGAGGAGGCCAGGTGTGG + Intronic
1159553030 18:69916910-69916932 TCTTGATAGCAGGTCATGTGGGG - Intronic
1159672055 18:71233048-71233070 AATGGATAGAAGGCCAGGTATGG - Intergenic
1161379344 19:3956455-3956477 TACACATAGCAGGCCAGGTGCGG + Intergenic
1161758531 19:6152951-6152973 TTTAAATATCAGGCCGGGTGTGG + Intronic
1162417622 19:10547471-10547493 TAGAGACATAAGGCCAGGTGTGG + Intronic
1162477731 19:10911179-10911201 AAGAGAAAACAGGCCAGGTGCGG - Intronic
1162618087 19:11817917-11817939 TATAATTATCAGGCCAGGTGTGG + Intronic
1162739379 19:12765455-12765477 AAAAGAAAGCAGGCCAGGCGCGG + Intronic
1162759391 19:12879811-12879833 TACAAAAAGTAGGCCAGGTGTGG + Intronic
1162961452 19:14129746-14129768 TATAGGTATAGGGCCAGGTGAGG + Intronic
1162972649 19:14190213-14190235 TAATAATAGCAGGCCAGGTGTGG - Intronic
1163119901 19:15211181-15211203 GAAAGAGAGCAGGCCAGGCGTGG - Intergenic
1163408542 19:17138879-17138901 TAGATGTAGCTGGCCAGGTGCGG + Intronic
1163541386 19:17912962-17912984 AATAAATTGCTGGCCAGGTGTGG - Intergenic
1163624182 19:18379186-18379208 TATAAAGATTAGGCCAGGTGTGG + Intronic
1163707986 19:18827666-18827688 GAAAAATAGGAGGCCAGGTGCGG - Intergenic
1163784076 19:19265707-19265729 TACAGACAGAAGGCCAGGTGAGG - Intronic
1163884302 19:19952295-19952317 TACAGATAGTGGCCCAGGTGGGG + Intergenic
1163898694 19:20081671-20081693 TACAGATAGTGGCCCAGGTGGGG - Intronic
1163908942 19:20171637-20171659 TACAGATAGTGGCCCAGGTGGGG - Intronic
1163913268 19:20215372-20215394 TACAGATAGTTGACCAGGTGGGG + Intergenic
1163933399 19:20420623-20420645 TATAGATAGTAGCCCAGGTGGGG + Intergenic
1163957518 19:20658173-20658195 TACAGATAGTGGCCCAGGTGGGG + Intronic
1163959185 19:20671341-20671363 TACAGATAGTGGCCCAGGTGGGG - Intronic
1164000337 19:21092505-21092527 TACAGATAGTGGCCCAGGTGGGG - Intronic
1164025299 19:21346334-21346356 TAGAAATTGTAGGCCAGGTGTGG + Intergenic
1164095353 19:22004986-22005008 TATAGATAGTGGCCCAGGTGGGG + Intronic
1164114830 19:22209717-22209739 TATAGATAGTGGCCCAGGTGGGG + Intergenic
1164241019 19:23389219-23389241 TACAGATAGTGGCCCAGGTGGGG + Intronic
1164744383 19:30600382-30600404 AATAAACAGCCGGCCAGGTGCGG - Intronic
1165191598 19:34068267-34068289 TACGTATACCAGGCCAGGTGAGG + Intergenic
1165725039 19:38106782-38106804 GTTAGAGAGCAGCCCAGGTGTGG + Intronic
1165777301 19:38412410-38412432 TCTAGATAGGAGGCCAGGAGTGG - Intronic
1165816497 19:38645631-38645653 AATAAATATCCGGCCAGGTGTGG - Intergenic
1166037012 19:40175900-40175922 AATAAAAAGCAGGCCGGGTGCGG - Intergenic
1166042400 19:40212013-40212035 AATCCATACCAGGCCAGGTGCGG - Intronic
1166134512 19:40767635-40767657 TAAATACAGTAGGCCAGGTGCGG + Intergenic
1166194481 19:41196904-41196926 TTTACAGAACAGGCCAGGTGCGG + Intronic
1166202204 19:41245202-41245224 TATAGACTTCAGGCCAGGCGTGG - Intronic
1166374538 19:42320234-42320256 TGTACATGGCAGGCGAGGTGGGG + Intronic
1166525095 19:43505541-43505563 TGGAGATAGTAGGCCAGGAGCGG - Intergenic
1166889156 19:45979778-45979800 TTAAAATTGCAGGCCAGGTGTGG - Intergenic
1167020265 19:46869299-46869321 TATATATAGTTGGCCAGGCGTGG + Intergenic
1167111796 19:47466775-47466797 TGTTCATAGCAGGCCGGGTGCGG + Intronic
1167284868 19:48593259-48593281 GAGAGAGAGAAGGCCAGGTGTGG + Intronic
1167303603 19:48694544-48694566 TATGCAAAACAGGCCAGGTGTGG - Intergenic
1167629013 19:50612061-50612083 AAAAGATAGTTGGCCAGGTGTGG - Intergenic
1168050750 19:53827837-53827859 TATATATAGAAGGCTGGGTGTGG + Intergenic
1168379382 19:55907246-55907268 TACAGATTCCAGGCCAGGTGTGG - Intronic
1168388130 19:55983171-55983193 TTTTGAAAGTAGGCCAGGTGCGG + Intronic
1168399776 19:56078833-56078855 TATATATATCAGGCCAGGTGCGG + Intergenic
1168587097 19:57602497-57602519 TATTAATAGCAGGCCAGGAAGGG + Intronic
1168660696 19:58163628-58163650 CATGGAAATCAGGCCAGGTGTGG - Intergenic
926172842 2:10564029-10564051 AAGAAAAAGCAGGCCAGGTGCGG + Intergenic
926289144 2:11515016-11515038 GATAGATAGATGGTCAGGTGGGG - Intergenic
927547396 2:23966423-23966445 AATATCTACCAGGCCAGGTGCGG - Intronic
927548167 2:23973307-23973329 AATATCTACCAGGCCAGGTGCGG - Intronic
927549941 2:23989541-23989563 TATAGAAATAAGGCCGGGTGTGG - Intronic
927663021 2:25008805-25008827 GAGAGAAAGCAGGCCGGGTGTGG - Intergenic
927933006 2:27057783-27057805 TAGAAAGAGCTGGCCAGGTGCGG + Intronic
928000745 2:27521232-27521254 AATTGATTTCAGGCCAGGTGTGG + Intronic
928001774 2:27529507-27529529 TGTGAATAGCCGGCCAGGTGCGG + Intergenic
928545684 2:32327400-32327422 TAGATATAATAGGCCAGGTGTGG - Intergenic
928649866 2:33392615-33392637 AATAGGTAGCAGGCCAGATTTGG + Intronic
928707321 2:33964328-33964350 AATATTTAACAGGCCAGGTGCGG - Intergenic
929290155 2:40181248-40181270 TATAGAAAATAGGCCAGGTGTGG - Intronic
929290526 2:40185590-40185612 TAGAGATAAAAGGCCGGGTGGGG + Intronic
929680583 2:43989921-43989943 AATAAACATCAGGCCAGGTGCGG + Intronic
930383532 2:50662218-50662240 TGAATATAGCAGGGCAGGTGTGG - Intronic
930808447 2:55516636-55516658 TATGTATAACAGGCCGGGTGCGG - Intergenic
931071876 2:58660667-58660689 TATATATAGATAGCCAGGTGTGG + Intergenic
931129635 2:59320455-59320477 TAGAGATACAAGGCCGGGTGCGG + Intergenic
931391187 2:61845530-61845552 TAAAGAATGGAGGCCAGGTGTGG + Intronic
932131098 2:69187877-69187899 AATACATGGTAGGCCAGGTGCGG - Intronic
932503908 2:72210531-72210553 AATAGATGGCAGGTCAGGAGAGG - Intronic
932558255 2:72844290-72844312 ATTAGATTGCTGGCCAGGTGTGG - Intergenic
933383975 2:81586657-81586679 TATGTATTGCTGGCCAGGTGCGG - Intergenic
933496751 2:83059509-83059531 AAGAGATAGTTGGCCAGGTGCGG + Intergenic
933502695 2:83135327-83135349 TATAGATCTTGGGCCAGGTGCGG - Intergenic
933676190 2:85059922-85059944 TATAGAAATGAGGCCAGGTGTGG - Intergenic
933808541 2:86017711-86017733 GTTAGAATGCAGGCCAGGTGCGG - Intergenic
934013586 2:87853511-87853533 TAGAGTTAAAAGGCCAGGTGTGG - Intergenic
934879545 2:97963422-97963444 TTGAGATTGCAGGCCAGGTATGG + Intronic
935649802 2:105372513-105372535 TATATGTAGGATGCCAGGTGTGG - Intronic
935717257 2:105950231-105950253 TATAGAAAGCAGGCCGGGCATGG + Intergenic
936121352 2:109748280-109748302 TATAAATGTTAGGCCAGGTGCGG - Intergenic
936170855 2:110172488-110172510 TATAAATTTCTGGCCAGGTGTGG + Intronic
936223345 2:110623192-110623214 TATAAATGTTAGGCCAGGTGCGG + Intergenic
936522942 2:113223206-113223228 TATATATGGCAGACCAGGAGGGG - Intronic
936686136 2:114828996-114829018 TCTAGTTACTAGGCCAGGTGCGG + Intronic
937587186 2:123567040-123567062 GAAAGAAATCAGGCCAGGTGCGG + Intergenic
937720410 2:125088710-125088732 TATTTATATCAGGCCAGGCGTGG - Intergenic
938546754 2:132340178-132340200 TACTGATAGCAGGCCAGGCGCGG + Intergenic
939893312 2:147763009-147763031 TATAGTCAACAGGCCAGGTGTGG - Intergenic
940071230 2:149690505-149690527 TATGGGTTTCAGGCCAGGTGTGG + Intergenic
940556452 2:155234218-155234240 TTCTGATAGGAGGCCAGGTGAGG - Intergenic
941179155 2:162236880-162236902 AACAGATAACAGGCCAGGCGTGG - Intronic
941751962 2:169143350-169143372 TATTGATGCCAGGCCAGGCGCGG + Intronic
941938105 2:171002562-171002584 TAGAAAAAGCAGGCCAGGCGCGG - Intronic
942019677 2:171854276-171854298 TCTGCATAGCAGGCCAGGCGCGG + Intronic
942128369 2:172850325-172850347 TAAAAATATCAGGCCAGGCGTGG + Intronic
942175482 2:173329442-173329464 AATAAAAAGCAGGCGAGGTGCGG - Intergenic
942384372 2:175425827-175425849 TTAAAAGAGCAGGCCAGGTGTGG + Intergenic
942618101 2:177815918-177815940 TCTACAGAGCAGGCCAGGTGTGG + Intronic
943027904 2:182651295-182651317 TAAAAATACAAGGCCAGGTGTGG - Intergenic
943058968 2:183017957-183017979 TAAAGATACCTGGCCGGGTGCGG + Intronic
943537449 2:189170005-189170027 TAATAATAACAGGCCAGGTGTGG - Intronic
943614274 2:190074359-190074381 AATAGAGAAAAGGCCAGGTGCGG + Intronic
943810995 2:192189251-192189273 TATAGATTGCAGGCTGGGTGTGG + Intronic
944158532 2:196634742-196634764 AATAAAGACCAGGCCAGGTGCGG + Intergenic
944200874 2:197106149-197106171 TATAGATAACTGGCCAGGCACGG + Intronic
944245362 2:197525053-197525075 AGTAGATAGCTGGCCGGGTGCGG + Intronic
944705860 2:202287819-202287841 AAGAGAAAGGAGGCCAGGTGTGG + Intronic
944711785 2:202341222-202341244 AATAAATAATAGGCCAGGTGTGG + Intergenic
944781384 2:203021301-203021323 TAAAGATTTCAGGGCAGGTGTGG + Intronic
944798989 2:203217092-203217114 TAGAGAAAGACGGCCAGGTGTGG - Intronic
944886211 2:204065025-204065047 AACAGATCCCAGGCCAGGTGCGG + Intergenic
945682493 2:212931061-212931083 GACAGTTACCAGGCCAGGTGTGG + Intergenic
945913449 2:215676799-215676821 AAGAGATATGAGGCCAGGTGTGG - Intergenic
946226843 2:218268630-218268652 TAGAGATAATTGGCCAGGTGCGG - Intronic
946919235 2:224560709-224560731 TGATGATAGCAGGCCAGGAGTGG - Intronic
948193665 2:236079083-236079105 TCTAGATGCCAGGCCTGGTGTGG - Intronic
1168855768 20:1006638-1006660 TAGAGATGGGAGGCCAGGCGTGG - Intergenic
1169006324 20:2210102-2210124 AACAGAAAGAAGGCCAGGTGCGG - Intergenic
1169098980 20:2929240-2929262 AAAAAACAGCAGGCCAGGTGTGG - Intronic
1169233049 20:3905635-3905657 AAGAGATAGCAGGCCGGGTGTGG - Intronic
1169467656 20:5855660-5855682 TGTGGTTGGCAGGCCAGGTGCGG - Intronic
1169949897 20:11032271-11032293 TAAAGAAAGCAGGCTTGGTGGGG + Intergenic
1170143146 20:13145063-13145085 TACACATAGTAGGCCAGGTGCGG - Intronic
1170515345 20:17123737-17123759 TATAGAGAGAGAGCCAGGTGTGG - Intergenic
1170640330 20:18146367-18146389 TATAAAAAACAGGCCAGGCGCGG + Intronic
1171175103 20:23046319-23046341 TATAAGTAGCAGGCCAAGTCAGG - Exonic
1171485557 20:25483042-25483064 TAAAGAAAAGAGGCCAGGTGTGG + Intronic
1171875620 20:30572904-30572926 TAGTGATAGCAGGCCAGCCGCGG + Intergenic
1172171882 20:32940961-32940983 TGTAGAAAGCTGGCCAGGTACGG + Intronic
1172361222 20:34313881-34313903 TACAGAAATAAGGCCAGGTGCGG + Intergenic
1172451955 20:35032313-35032335 TATAATAATCAGGCCAGGTGTGG - Intronic
1172456940 20:35084007-35084029 TACAGAAAGCAGGCCGGGCGCGG + Intronic
1172526928 20:35605525-35605547 AATAGCTTCCAGGCCAGGTGCGG + Intergenic
1172559513 20:35874264-35874286 AATTTATAGCAGGCCAGGTGTGG - Intronic
1172582082 20:36056303-36056325 TAGACAAAGCAGGCCAGCTGTGG - Intergenic
1173524016 20:43718421-43718443 GATAGAAACCAGGCCAGGTGTGG + Intergenic
1173604088 20:44317657-44317679 AATAAAAAGCAGGCCAGGAGCGG + Intergenic
1173653253 20:44681133-44681155 TAAAGATAATAGGCCAGGCGCGG - Intergenic
1173933664 20:46842842-46842864 TATACATAATAGGCCAGGTGTGG - Intergenic
1174032408 20:47640588-47640610 TAAAGATTGTAGGCCCGGTGTGG + Intronic
1174805740 20:53603137-53603159 TATAGACAACAGGCCGGGCGCGG + Intronic
1174844727 20:53933008-53933030 AATATATAGAAGGCCAAGTGTGG - Intergenic
1177986302 21:27979095-27979117 TATATATATCAGGCCAGGAATGG - Intergenic
1178020782 21:28406227-28406249 TATACAAAGATGGCCAGGTGCGG + Intergenic
1178274565 21:31225289-31225311 AATATATATCTGGCCAGGTGTGG - Intronic
1178484516 21:33010102-33010124 TAAAGAAAGGAGGCCAGGGGGGG + Intergenic
1179137392 21:38692292-38692314 CAAAAAGAGCAGGCCAGGTGCGG + Intergenic
1179139397 21:38710901-38710923 TATAAATAGCTGGCCAGGCACGG - Intergenic
1179216703 21:39373284-39373306 AAAAGATTCCAGGCCAGGTGGGG - Intergenic
1179463382 21:41553274-41553296 TAAAGATTACAGGCCGGGTGCGG + Intergenic
1179476064 21:41646048-41646070 AGTATAGAGCAGGCCAGGTGCGG - Intergenic
1181163407 22:20970891-20970913 AATGGAGAGAAGGCCAGGTGTGG - Intronic
1181526252 22:23490186-23490208 GTTGGATAGCTGGCCAGGTGTGG + Intergenic
1181545713 22:23600960-23600982 TAGAAATTGCCGGCCAGGTGCGG - Intergenic
1181596801 22:23920748-23920770 TATACTAAGCAGGCTAGGTGTGG + Intergenic
1181721513 22:24778555-24778577 TTTTGATAGTAGGCCAGGCGCGG - Intergenic
1181789586 22:25253958-25253980 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1181824407 22:25502782-25502804 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1182137090 22:27916519-27916541 AATAAATAGAGGGCCAGGTGCGG + Intronic
1182139506 22:27941137-27941159 TACAAAAAGAAGGCCAGGTGTGG - Intergenic
1182214109 22:28701500-28701522 TATAGACAACAGGCTGGGTGTGG - Intronic
1182479821 22:30600524-30600546 TATAAAAATAAGGCCAGGTGTGG + Intronic
1182544523 22:31067044-31067066 TTAAAATTGCAGGCCAGGTGTGG - Intronic
1182581124 22:31312298-31312320 TACAAAAATCAGGCCAGGTGCGG + Intergenic
1182728742 22:32470498-32470520 AATGTTTAGCAGGCCAGGTGCGG + Intergenic
1182733854 22:32516654-32516676 AAAAGGTATCAGGCCAGGTGTGG - Intronic
1182814596 22:33149330-33149352 TTAAGAAAACAGGCCAGGTGCGG - Intergenic
1183450190 22:37889808-37889830 TAAGGTTAGCAGGCCAGGCGCGG + Intergenic
1183464054 22:37970310-37970332 TGGAGATAATAGGCCAGGTGCGG + Intronic
1183652076 22:39162426-39162448 TATTGCAAGCAGGCTAGGTGTGG + Intergenic
1184202314 22:42979231-42979253 TAGAGATATTTGGCCAGGTGCGG + Intronic
1184938963 22:47746925-47746947 TCAAGATGGAAGGCCAGGTGCGG + Intergenic
950010514 3:9719701-9719723 TATACAAAGCAGGCCAGGTGTGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
951535594 3:23737886-23737908 TAAGAAAAGCAGGCCAGGTGTGG + Intergenic
951763704 3:26173141-26173163 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
951897625 3:27625485-27625507 TAAAGAGGGTAGGCCAGGTGCGG + Intergenic
951929971 3:27954636-27954658 ACTAGACAGAAGGCCAGGTGCGG + Intergenic
952799738 3:37278491-37278513 TATGGATTTTAGGCCAGGTGTGG - Intronic
952938214 3:38417899-38417921 TATATATATCAGGCCGGGCGTGG + Intronic
953169363 3:40493412-40493434 AAGAAATAGAAGGCCAGGTGCGG - Intergenic
953171730 3:40513344-40513366 TATATATATATGGCCAGGTGTGG + Intronic
953724361 3:45384704-45384726 AAAAGAAAACAGGCCAGGTGTGG - Intergenic
953756608 3:45651920-45651942 AATAAATAACAGGCCGGGTGCGG - Intronic
954244305 3:49318616-49318638 TATAAACAACCGGCCAGGTGTGG + Intronic
954376992 3:50200353-50200375 TATATATATTTGGCCAGGTGCGG + Intergenic
955285660 3:57638810-57638832 GAAAAATAACAGGCCAGGTGTGG + Intronic
955788174 3:62561558-62561580 AAGAGATATCTGGCCAGGTGTGG - Intronic
956252822 3:67252676-67252698 TCCAGATCTCAGGCCAGGTGCGG - Intergenic
956566027 3:70639597-70639619 TAATGATTCCAGGCCAGGTGTGG - Intergenic
956627360 3:71279831-71279853 AATAGAATGCAGGCCAGGCGCGG + Intronic
956840589 3:73136177-73136199 TATACAGAATAGGCCAGGTGCGG - Intergenic
957543524 3:81607258-81607280 TAAATATGGCAGGCCAGGAGTGG + Intronic
959295027 3:104524190-104524212 TAAAAATATCTGGCCAGGTGCGG + Intergenic
959954961 3:112226429-112226451 AATAGACAGAGGGCCAGGTGTGG + Intronic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960399383 3:117177571-117177593 AAAAAATAGCAGGCCGGGTGCGG - Intergenic
960853975 3:122084275-122084297 AATATAAAACAGGCCAGGTGTGG - Intronic
961475871 3:127145961-127145983 GAGAGATTGGAGGCCAGGTGTGG - Intergenic
961751215 3:129095896-129095918 GATGGATACCAGGCCAGGTAGGG + Intronic
962078121 3:132106441-132106463 TAGAAACAGAAGGCCAGGTGTGG - Intronic
962305584 3:134283155-134283177 AATAGATATTAGGGCAGGTGCGG + Intergenic
962726094 3:138228268-138228290 TTTAGAATGCAGGCCAGGAGCGG - Intronic
964455257 3:156858380-156858402 TATATTTATCAGGCCAGGCGCGG + Intronic
964631425 3:158814609-158814631 AGTAGACAACAGGCCAGGTGCGG - Intronic
964713187 3:159694193-159694215 TAGAGATTGTGGGCCAGGTGCGG + Intronic
964936096 3:162089777-162089799 TATTGATAGAAAGGCAGGTGAGG + Intergenic
965556731 3:170026136-170026158 CCTAGATAATAGGCCAGGTGTGG - Intergenic
965825807 3:172728316-172728338 AAAAGGAAGCAGGCCAGGTGCGG - Intergenic
966175682 3:177135670-177135692 TATACAAAGTGGGCCAGGTGCGG - Intronic
966393976 3:179482184-179482206 TAAAAGAAGCAGGCCAGGTGTGG - Intergenic
966430208 3:179824413-179824435 AAAAGAAAGTAGGCCAGGTGTGG + Intronic
966502380 3:180657947-180657969 TATTAATAGCAGGCCAGGTGCGG + Intronic
966614914 3:181903003-181903025 TAGAGATATGTGGCCAGGTGCGG - Intergenic
966850056 3:184159065-184159087 TTAAGATGGCAGGCCAGGCGCGG - Intronic
966867084 3:184264340-184264362 TATAGTTATAAGGCCGGGTGTGG - Intronic
966950269 3:184811014-184811036 AATACATTTCAGGCCAGGTGCGG - Intergenic
967031374 3:185610450-185610472 GCTAGATAGTAGGCCGGGTGCGG - Intronic
967431512 3:189391417-189391439 AAAAGATATCTGGCCAGGTGTGG - Intergenic
967641229 3:191866685-191866707 TAAAGATTTCCGGCCAGGTGGGG + Intergenic
967662263 3:192127478-192127500 AAAAGACTGCAGGCCAGGTGCGG + Intergenic
967667083 3:192185569-192185591 TATAGCTAATAGGCCAGGCGTGG + Intronic
967788191 3:193519933-193519955 TAGAAATTGCAGGCCAGGTGCGG - Intronic
967798681 3:193629201-193629223 AAAAGACAGCTGGCCAGGTGCGG - Intronic
968023466 3:195417220-195417242 TAAAGATTTGAGGCCAGGTGTGG - Intronic
968111033 3:196046950-196046972 TATACAAAGCTGGCCAGGTGCGG + Intronic
968169088 3:196494136-196494158 AATAGCAAACAGGCCAGGTGCGG - Intronic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968376759 4:50290-50312 TATAAATAGCCGGCCGGGCGCGG + Intergenic
968379144 4:74015-74037 TAAAGATATCAGACCAGGTGCGG + Intronic
968758946 4:2431870-2431892 TACACAAAGCTGGCCAGGTGTGG - Intronic
968864070 4:3196444-3196466 TATCCATTGCAGGCCAGGTGTGG + Intronic
969340391 4:6536910-6536932 GAAAGATATCAGGTCAGGTGAGG + Intronic
969385021 4:6838836-6838858 TAAATAAAGCTGGCCAGGTGAGG + Intronic
970325649 4:14920665-14920687 TAGAGAAACAAGGCCAGGTGCGG + Intergenic
970548165 4:17150945-17150967 TACAGATAAGAGGCCAGGCGTGG + Intergenic
970568631 4:17357418-17357440 AATAGGTAGCAGGCCAGATTTGG - Intergenic
970588693 4:17539572-17539594 TTTAGAAAATAGGCCAGGTGTGG + Intergenic
971095409 4:23395940-23395962 ACTAGAAAACAGGCCAGGTGCGG - Intergenic
971236328 4:24845367-24845389 TAGAGAGTGCAGCCCAGGTGGGG - Intronic
971294082 4:25373980-25374002 TAAAGAAGACAGGCCAGGTGCGG + Intergenic
972086515 4:35223747-35223769 AATGGAAAACAGGCCAGGTGTGG + Intergenic
972541183 4:40040773-40040795 TATCTCAAGCAGGCCAGGTGTGG - Intergenic
972596708 4:40535846-40535868 AATATATACGAGGCCAGGTGTGG - Intronic
973330663 4:48907421-48907443 TATAGAAAACAGGCCGGGTGCGG + Intergenic
973816190 4:54621606-54621628 TATGGACTGCAGGCCAGGTGCGG - Intergenic
973971551 4:56218399-56218421 GAAAGAAAGCAGACCAGGTGAGG - Intronic
973980718 4:56306201-56306223 GATAAATATCAGGCCAGGTGTGG + Intronic
974046805 4:56905341-56905363 TATATATAATTGGCCAGGTGTGG + Intergenic
974388069 4:61228980-61229002 GATAAATAAGAGGCCAGGTGTGG - Intronic
974591591 4:63954886-63954908 TAGAGATACTTGGCCAGGTGTGG - Intergenic
975151060 4:71021363-71021385 TAGAAATAGCAGGCCGGGCGCGG - Intronic
975170283 4:71225059-71225081 AATAGATAATGGGCCAGGTGCGG + Intronic
975303610 4:72821526-72821548 TAAAAACAACAGGCCAGGTGTGG + Intergenic
975582259 4:75917754-75917776 AAGTGAAAGCAGGCCAGGTGCGG - Intronic
975684899 4:76909977-76909999 TAGAGTTGGCAGGGCAGGTGAGG - Intergenic
976028795 4:80725244-80725266 ATAAGAAAGCAGGCCAGGTGTGG - Intronic
976245695 4:83004105-83004127 TGTAGAAAACAGGCCGGGTGCGG + Intronic
976291162 4:83419285-83419307 TATTGAAAGTAGACCAGGTGTGG + Intronic
976427442 4:84921943-84921965 AAATGAAAGCAGGCCAGGTGCGG - Intronic
976599541 4:86925505-86925527 TATAGTTTGGGGGCCAGGTGTGG - Intronic
976662273 4:87552055-87552077 AATAGCTTGAAGGCCAGGTGTGG + Intergenic
976853886 4:89580367-89580389 TATAGACTGAAGTCCAGGTGTGG - Intergenic
976880782 4:89922394-89922416 TATTGAGTACAGGCCAGGTGCGG - Intronic
977248771 4:94665191-94665213 AATAAATAGAGGGCCAGGTGTGG + Exonic
978170566 4:105665202-105665224 TTTTAGTAGCAGGCCAGGTGCGG + Intronic
978320277 4:107485942-107485964 AATAAATATCAGGCCAGGCGTGG + Intergenic
978534569 4:109747445-109747467 AATTGATAAGAGGCCAGGTGCGG - Intronic
978579013 4:110214049-110214071 TCTAGAGAGTTGGCCAGGTGTGG + Intergenic
978605119 4:110471461-110471483 AATAAAAATCAGGCCAGGTGAGG - Intronic
978806514 4:112806538-112806560 TACTGATTTCAGGCCAGGTGTGG + Intergenic
979551304 4:121994064-121994086 AATAAAAAGCAGGCCAGGTGCGG - Intergenic
979595213 4:122527257-122527279 TATAGATAGAAGGCCGGGCACGG + Intergenic
979709454 4:123761281-123761303 TATAGAACAGAGGCCAGGTGCGG + Intergenic
980020764 4:127707132-127707154 AAGAAATATCAGGCCAGGTGTGG + Intronic
980209512 4:129768279-129768301 TCTAGTTTTCAGGCCAGGTGCGG - Intergenic
980622952 4:135333376-135333398 TATATAGTGCAGGCCAGGTGTGG + Intergenic
981091229 4:140734499-140734521 TACATAACGCAGGCCAGGTGCGG + Intronic
981548944 4:145923312-145923334 GATTGAATGCAGGCCAGGTGCGG + Intronic
982971971 4:162000298-162000320 GAAATATAACAGGCCAGGTGTGG + Intronic
983195562 4:164802524-164802546 TATAAATAACAGGCCAGGCATGG - Intergenic
983207142 4:164922320-164922342 TTAAGATAACTGGCCAGGTGTGG - Intergenic
984192562 4:176623561-176623583 TATAGACAGTGGGCCAGGTGTGG + Intergenic
984217248 4:176929036-176929058 GAAAGATTGCAGGCCAGGTGCGG - Intergenic
984270519 4:177543442-177543464 TATAAAGGCCAGGCCAGGTGTGG + Intergenic
984347862 4:178554055-178554077 TAAATATTGCAGGCTAGGTGTGG - Intergenic
984970827 4:185188309-185188331 TATATATATGAAGCCAGGTGTGG - Intronic
985221055 4:187705959-187705981 TATACATAACAGGCCGGGCGCGG + Intergenic
985470868 5:44804-44826 TAAAGATTACAGGCCAGGTGCGG + Intergenic
985813108 5:2105088-2105110 AATAAATTGCAGGCCAGGTGTGG + Intergenic
986055340 5:4130818-4130840 TTTAAAGAGCAGGCCAGGTTTGG - Intergenic
987068731 5:14315539-14315561 TCTAGTAAGCAGGCCGGGTGTGG - Intronic
987191608 5:15484474-15484496 GATAGATAAAAGACCAGGTGCGG - Intergenic
987376003 5:17235550-17235572 CATAAAGAGCAGGCCAGGCGTGG - Intronic
987553402 5:19413309-19413331 TAAAGATAGCAGTGTAGGTGGGG - Intergenic
987833687 5:23133715-23133737 AATAGAAAAAAGGCCAGGTGTGG + Intergenic
988827083 5:34948574-34948596 TAGTGAGAGCTGGCCAGGTGCGG + Intronic
988830465 5:34982057-34982079 TATAGATGGCACCCCAGGTGTGG - Intergenic
988874940 5:35433663-35433685 TATAAAAAAGAGGCCAGGTGTGG + Intergenic
988945278 5:36190363-36190385 TAAAGATAACAAGCCTGGTGAGG - Intergenic
988973248 5:36490564-36490586 TAGAACTAGGAGGCCAGGTGCGG + Intergenic
989365105 5:40647228-40647250 TAGTAATAACAGGCCAGGTGCGG + Intergenic
989764897 5:45070895-45070917 TATAGGTGTCAGGCCCGGTGGGG + Intergenic
990638607 5:57757461-57757483 AATAGATTGCAGGCTGGGTGTGG - Intergenic
991419288 5:66425083-66425105 TATAGATGGCAAGCCAGCAGAGG + Intergenic
992696084 5:79288942-79288964 TATGGGTTGTAGGCCAGGTGTGG + Intronic
993073282 5:83192599-83192621 TATTGATAATCGGCCAGGTGCGG - Intronic
993461824 5:88191665-88191687 AATACATAGCCGGCCAGGCGCGG + Intronic
993793195 5:92232967-92232989 TATAGAAACCTGGCCGGGTGCGG - Intergenic
994981883 5:106885874-106885896 AAAAGATAGCTGGCCAGGTGAGG + Intergenic
995294031 5:110497714-110497736 TGTGTAAAGCAGGCCAGGTGGGG - Intronic
995501091 5:112807862-112807884 AATACATAACTGGCCAGGTGTGG + Intronic
995579275 5:113577658-113577680 TATACAAAAGAGGCCAGGTGCGG - Intronic
995917722 5:117269749-117269771 AATAAACAACAGGCCAGGTGCGG + Intergenic
995948478 5:117680349-117680371 AAAAGAAAGCAGGCCAGGTGCGG - Intergenic
996814427 5:127559099-127559121 TATTGATAGGTGGCCAGGCGCGG - Intergenic
997469575 5:134109477-134109499 TAGAGACACCTGGCCAGGTGCGG + Intergenic
997525332 5:134549367-134549389 TATAAAAACTAGGCCAGGTGCGG + Intronic
998042096 5:138957278-138957300 TACAGAAAATAGGCCAGGTGTGG + Intronic
998079143 5:139260275-139260297 TTTAGAAAGTAGACCAGGTGAGG - Intronic
998168174 5:139856276-139856298 CAGAGATAGCAGGCCTGGAGGGG - Intronic
998311837 5:141140151-141140173 TATCTATAGATGGCCAGGTGTGG - Intronic
999313230 5:150566691-150566713 TATATATAGCCGGCCACATGTGG - Intergenic
999335381 5:150711659-150711681 TATATAAAGCTAGCCAGGTGTGG - Intronic
999778248 5:154828137-154828159 TAAATAAAACAGGCCAGGTGTGG - Intronic
1000042513 5:157495289-157495311 TACATAAAACAGGCCAGGTGTGG - Intronic
1000966019 5:167657808-167657830 AATAGATAGTAGGCCAAATGTGG + Intronic
1001805505 5:174582382-174582404 AATAGCTTGCAGGCCAGGCGTGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002285039 5:178156661-178156683 AAAAGAAAACAGGCCAGGTGCGG - Intergenic
1002479146 5:179487911-179487933 TATATATATATGGCCAGGTGTGG + Intergenic
1002489620 5:179565467-179565489 CCTAGAAAGTAGGCCAGGTGTGG - Intronic
1002509768 5:179706745-179706767 TAGAAATTTCAGGCCAGGTGCGG - Intronic
1002511044 5:179718004-179718026 TAAAGAAAAGAGGCCAGGTGTGG - Intronic
1002549614 5:179977560-179977582 TAAAGAAAACAGGCCGGGTGCGG + Intronic
1002969454 6:1999031-1999053 TGCAGATAATAGGCCAGGTGCGG + Intronic
1003630564 6:7782552-7782574 AATATAAAACAGGCCAGGTGAGG + Intronic
1004064212 6:12227078-12227100 TATATATTACAGGCCAGGCGTGG - Intergenic
1004105044 6:12659811-12659833 AATAGGTAACAGGCCAGGCGTGG + Intergenic
1004309025 6:14528057-14528079 TAAACATGGGAGGCCAGGTGCGG + Intergenic
1004640369 6:17509385-17509407 TATAAAAAGCAGACCAGGTGTGG + Intronic
1004924779 6:20405499-20405521 TGTAGATAACCGGCCAGGCGTGG - Intronic
1005009940 6:21326130-21326152 TAAAGAAAGAAGGCCAGGCGCGG - Intergenic
1005083369 6:21979905-21979927 AATGGATATGAGGCCAGGTGCGG - Intergenic
1005501003 6:26429287-26429309 TATATATAGCCTGCCAGGGGAGG + Intergenic
1005600449 6:27421775-27421797 TTCAGAGAGCAGGCCTGGTGTGG + Intergenic
1006073285 6:31512355-31512377 AAAAGAGAACAGGCCAGGTGCGG - Intergenic
1006106965 6:31722564-31722586 TAGAAATAGTAGGCCGGGTGTGG + Intronic
1006193958 6:32226174-32226196 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
1006432547 6:34006792-34006814 AGTAGAAAGCAGGCCGGGTGCGG + Intergenic
1007100462 6:39242717-39242739 TAAAAAAAGCAAGCCAGGTGCGG + Intergenic
1007435707 6:41809199-41809221 TAAAGAGACTAGGCCAGGTGTGG - Intronic
1007898327 6:45385607-45385629 TCTTAAAAGCAGGCCAGGTGTGG + Intronic
1008039686 6:46783911-46783933 AAGAGATAACAGGCCAGGTATGG - Intergenic
1008769221 6:54959257-54959279 AACAGATAGCAGGCCCGGCGCGG + Intergenic
1008911660 6:56740156-56740178 TTAAGAAAGTAGGCCAGGTGCGG - Intronic
1009968579 6:70603369-70603391 AACAAATAGCAGGCCAGGTGCGG - Intergenic
1009979611 6:70711801-70711823 TATACATATTAGGCCAGGTGCGG - Intronic
1010208352 6:73342865-73342887 TATATACAGTGGGCCAGGTGCGG - Intergenic
1010223031 6:73464029-73464051 TATAAACAACAGGCCAGGTGTGG - Intronic
1010438123 6:75859588-75859610 TAGAGACAACAGGCCAGGCGCGG - Intronic
1010817658 6:80377330-80377352 CATAAAAATCAGGCCAGGTGTGG - Intergenic
1010976758 6:82324406-82324428 TATCAATATCAGGCCAGGTGCGG + Intergenic
1011688655 6:89845204-89845226 TACTGATACCAGGCCAGGTGCGG - Intronic
1012274987 6:97262352-97262374 AAAAGATAGCAGGCCAGGCATGG + Intronic
1012562969 6:100609050-100609072 TATTTATAGCAGGCCAGGCGCGG - Intronic
1013018821 6:106189312-106189334 AAAAGAAAACAGGCCAGGTGTGG + Intronic
1013229035 6:108144711-108144733 TAAAAATTCCAGGCCAGGTGCGG - Intronic
1013521355 6:110936591-110936613 TATAGATCCCAGGCCGGGCGTGG - Intergenic
1013560915 6:111304008-111304030 TAAAAATATCTGGCCAGGTGTGG - Intronic
1013837406 6:114348946-114348968 TACAGATATTAGGCCAGGTGTGG + Intergenic
1014815018 6:125926018-125926040 TTTAGCTAAAAGGCCAGGTGTGG + Intronic
1015174430 6:130291244-130291266 TATAAATAAAAAGCCAGGTGTGG - Intronic
1015381517 6:132575267-132575289 TACAGCTAGTAGGCTAGGTGCGG + Intergenic
1015720361 6:136235178-136235200 TCTAGGAATCAGGCCAGGTGCGG - Intronic
1015989662 6:138925053-138925075 AAAAGACATCAGGCCAGGTGTGG + Intronic
1016332853 6:142971909-142971931 TATATATAGCATGGCAGTTGTGG - Intergenic
1016646469 6:146414690-146414712 AATAAAAGGCAGGCCAGGTGTGG - Intronic
1017203204 6:151777407-151777429 AATAGAAAATAGGCCAGGTGCGG - Intronic
1017807472 6:157958180-157958202 TACTGAAAGGAGGCCAGGTGTGG - Intergenic
1017809825 6:157976852-157976874 TAAAGATGCCAGACCAGGTGGGG + Intergenic
1017898380 6:158700904-158700926 TAAATACAACAGGCCAGGTGCGG - Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1018013151 6:159689991-159690013 CATACATACAAGGCCAGGTGAGG + Intronic
1018401497 6:163425341-163425363 TACAGAAAGCAGACCAGGTTAGG + Intronic
1018504842 6:164454818-164454840 TTTAGAAATCAGGCCAGGCGTGG + Intergenic
1018550064 6:164985898-164985920 TAAAGATATTGGGCCAGGTGTGG - Intergenic
1018581955 6:165315447-165315469 TATAGAGAACAGGCCAAGTACGG - Intergenic
1018638854 6:165888572-165888594 GAAAAAAAGCAGGCCAGGTGCGG - Intronic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019274544 7:168899-168921 TATATGTACCAGGCCAGGTGTGG + Intergenic
1019979536 7:4611127-4611149 AATTAACAGCAGGCCAGGTGTGG + Intergenic
1020046202 7:5042477-5042499 AATGCATAGCAGGCCAGGTGCGG + Intronic
1020065633 7:5186393-5186415 TATATATTGCAGGCCGGGCGTGG + Intergenic
1020065979 7:5189016-5189038 TATAAATAGAAGGCCAGGTGTGG - Intergenic
1020089243 7:5329010-5329032 TATTGATAGAAGGCCAGGCGTGG + Intronic
1020162991 7:5786368-5786390 CAAAGAAAACAGGCCAGGTGTGG - Intergenic
1020167912 7:5822779-5822801 TATAAACAGTAGGCCAGGCGCGG - Intergenic
1020352257 7:7233726-7233748 AACAGGTAGCAGGCCAGGTTTGG + Intronic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1020836182 7:13154586-13154608 TATAAATTCCCGGCCAGGTGCGG + Intergenic
1020891826 7:13888073-13888095 TAAAGCTATCAGGCCAGGCGCGG + Intergenic
1021098849 7:16565151-16565173 TAAAGATTACTGGCCAGGTGCGG + Intronic
1021268012 7:18548947-18548969 TATAAAAAATAGGCCAGGTGTGG + Intronic
1021494993 7:21264622-21264644 TATAGAACTAAGGCCAGGTGTGG - Intergenic
1021543640 7:21788996-21789018 GAAAAATAACAGGCCAGGTGTGG + Intronic
1022007329 7:26278063-26278085 TATAGAAATCAGGCCAGGCGCGG + Intergenic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1022160195 7:27702673-27702695 TCTACATAGAGGGCCAGGTGTGG + Intergenic
1022386869 7:29908618-29908640 GATAGATATCAGGCCAGGCATGG + Intronic
1022614239 7:31912393-31912415 CATAGATAAAAGGCCGGGTGTGG + Intronic
1022651586 7:32282184-32282206 TATAGATGGTCGGCCGGGTGTGG + Intronic
1022672868 7:32472529-32472551 AATAGGAAGCAAGCCAGGTGCGG + Intergenic
1022734702 7:33064826-33064848 GAAAGAAATCAGGCCAGGTGAGG + Intergenic
1023066343 7:36381378-36381400 TATAGGAAGGAGGCCAGGTGCGG + Intronic
1023380339 7:39600685-39600707 TAAAAACAGCAGGCCAGGGGCGG - Intronic
1023438789 7:40165823-40165845 TAACAATTGCAGGCCAGGTGTGG + Intronic
1023525873 7:41102440-41102462 TACAGATAGCAGGCTGGGTGCGG + Intergenic
1024602490 7:50996016-50996038 GAGAGATAAGAGGCCAGGTGTGG - Intergenic
1024994099 7:55258091-55258113 TATAGAAAGCCGGCCGGGCGCGG - Intergenic
1025016457 7:55442824-55442846 AATAAAAAGCAGGCCGGGTGCGG + Intronic
1025063882 7:55836029-55836051 TATGGTAACCAGGCCAGGTGTGG - Intronic
1025203042 7:56973905-56973927 TACAAAAATCAGGCCAGGTGCGG - Intergenic
1025668902 7:63603021-63603043 TACAAAAATCAGGCCAGGTGCGG + Intergenic
1025775577 7:64558081-64558103 TACAGATAGTGGCCCAGGTGGGG + Intronic
1025900823 7:65743310-65743332 TAAAAATAAAAGGCCAGGTGCGG + Intergenic
1026020816 7:66704518-66704540 TTTAAATAGTCGGCCAGGTGCGG + Intronic
1026030760 7:66791821-66791843 TATAGAAAAGATGCCAGGTGCGG + Intronic
1026181546 7:68045473-68045495 AATAGAAAAGAGGCCAGGTGAGG + Intergenic
1026304036 7:69124606-69124628 TTTAAATATTAGGCCAGGTGCGG - Intergenic
1026456616 7:70578118-70578140 TATGGACAAAAGGCCAGGTGCGG - Intronic
1026495425 7:70897634-70897656 AATAAATAAAAGGCCAGGTGTGG - Intergenic
1026635250 7:72076306-72076328 AAAAAAAAGCAGGCCAGGTGCGG + Intronic
1026636076 7:72082909-72082931 GCAAGAAAGCAGGCCAGGTGTGG + Intronic
1026683351 7:72487393-72487415 AATAGAGAGGTGGCCAGGTGCGG + Intergenic
1027117071 7:75489676-75489698 AATGTATAGCAGGCCAGGCGCGG - Intergenic
1027129411 7:75580445-75580467 AATATCTAGGAGGCCAGGTGTGG + Intronic
1027159788 7:75793938-75793960 AAAAGAAAGCGGGCCAGGTGAGG + Intergenic
1027179240 7:75926503-75926525 TATTGAGTGCTGGCCAGGTGTGG + Intronic
1027191593 7:75999834-75999856 TATACATAACAGGCCGGGCGCGG - Intronic
1027274738 7:76545928-76545950 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1027922540 7:84413335-84413357 TGTAGAAAGCAGGCCGAGTGTGG + Intronic
1027931534 7:84541815-84541837 AAGTGATAGGAGGCCAGGTGCGG - Intergenic
1028167987 7:87561693-87561715 TACACATGACAGGCCAGGTGTGG + Intronic
1028358006 7:89932895-89932917 TACAGAGAGCAGGGCATGTGTGG - Intergenic
1028760332 7:94488607-94488629 TACAAATGACAGGCCAGGTGTGG - Intergenic
1029497725 7:100906093-100906115 AATAGAAAGTAGGCCAGGTGCGG - Intergenic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1029720432 7:102360386-102360408 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1029905801 7:104092398-104092420 AATAGCTTGTAGGCCAGGTGCGG - Intergenic
1032167215 7:129555038-129555060 TATATATACTTGGCCAGGTGAGG - Intergenic
1032256923 7:130304879-130304901 TGTAAATAGCAGGACAGGTTGGG + Intronic
1032542448 7:132714574-132714596 TTTAAAAAGCAGGCCAGGTATGG + Intronic
1032661845 7:133992571-133992593 TACAAAAATCAGGCCAGGTGCGG - Intronic
1032852455 7:135806686-135806708 TAAATATAGGAGGCCAGGCGAGG + Intergenic
1033056814 7:138062754-138062776 TAAAGAAAGCAGACCAGGTGGGG - Intronic
1033191652 7:139286216-139286238 TATAAAAATTAGGCCAGGTGTGG - Intronic
1034042189 7:147890559-147890581 TATTGATAGTAGCCCAGATGTGG + Intronic
1034230018 7:149516674-149516696 AATAAAAAGCAGGCCAGGCGCGG + Intergenic
1035552706 8:542572-542594 TACAGATAACAGGCCAGGCGCGG + Intronic
1035856535 8:2982063-2982085 TATGGGTAACAGGCCAGGTGCGG + Intronic
1035923378 8:3702538-3702560 AATAGAGTGCTGGCCAGGTGCGG + Intronic
1036437919 8:8752698-8752720 TCTAAAAATCAGGCCAGGTGTGG + Intergenic
1036475110 8:9086121-9086143 CAGGGATAGCGGGCCAGGTGTGG + Intronic
1036523853 8:9517181-9517203 TATAGTAAGCAGGCCAGGTGCGG - Intergenic
1036806994 8:11841960-11841982 TATAAACATTAGGCCAGGTGTGG + Intergenic
1036929774 8:12944389-12944411 TATATAGAAGAGGCCAGGTGTGG + Intergenic
1037602229 8:20406731-20406753 TATAAACAGCTGGCCTGGTGTGG - Intergenic
1039675934 8:39667089-39667111 TATAAAAATGAGGCCAGGTGTGG + Intronic
1039940720 8:42088334-42088356 TACAGAATGTAGGCCAGGTGTGG - Intergenic
1039957678 8:42219747-42219769 TTTAAAAAACAGGCCAGGTGTGG + Intergenic
1040696629 8:50007296-50007318 AAGAGAAAGCAGGCCAGGTAGGG - Intronic
1042234940 8:66602339-66602361 TATAGTTATACGGCCAGGTGTGG - Intronic
1042551647 8:69999303-69999325 AATAGCTATCAGGCCAGGCGCGG - Intergenic
1042745896 8:72105173-72105195 TAAAAATTGTAGGCCAGGTGTGG - Intronic
1042897609 8:73688002-73688024 TAAAGATAGTAGGCCGGGCGCGG - Intronic
1043150949 8:76715200-76715222 TAAAGAATGCAGGCCAGGCGTGG + Intronic
1043332432 8:79133940-79133962 TAGAGAAAGCAGGCCAGGTGTGG + Intergenic
1043384551 8:79735160-79735182 TATTGGTAGTAGGCCGGGTGCGG - Intergenic
1043577945 8:81679321-81679343 AAAACATAGCAGGCGAGGTGTGG + Intronic
1043967716 8:86497803-86497825 TACAAAAACCAGGCCAGGTGCGG + Intronic
1044206601 8:89498170-89498192 TATAGAAATAAGGCCAGGTGTGG + Intergenic
1044570131 8:93708986-93709008 AAGAGATAATAGGCCAGGTGCGG + Intronic
1044581106 8:93827119-93827141 TATATAAAACTGGCCAGGTGGGG - Intergenic
1044979054 8:97696825-97696847 TAAATATGGGAGGCCAGGTGTGG + Intronic
1045015756 8:98000306-98000328 TATGGATAACAGGCCAGGTGCGG + Intronic
1045219875 8:100188443-100188465 TATTTATAGCAGGCCAGGCTTGG - Intronic
1045400345 8:101809833-101809855 AAAAGAGAGCAGGCCAAGTGCGG - Intronic
1045936875 8:107690147-107690169 TACAAATCTCAGGCCAGGTGCGG - Intergenic
1046930148 8:119833621-119833643 TATAGACTACAGGCCAGGCGTGG + Intergenic
1047725076 8:127677181-127677203 AAAACAGAGCAGGCCAGGTGCGG - Intergenic
1048220326 8:132534985-132535007 TATAAGTAATAGGCCAGGTGTGG - Intergenic
1048913833 8:139163309-139163331 TAAAAATACCATGCCAGGTGTGG - Intergenic
1049024426 8:139979064-139979086 GGTTGACAGCAGGCCAGGTGCGG + Intronic
1049511283 8:143028052-143028074 AAAACATAACAGGCCAGGTGTGG - Intergenic
1049823212 8:144649151-144649173 TAGAAATGACAGGCCAGGTGCGG + Intergenic
1050342591 9:4655371-4655393 TATAGCTAGGAGGGCTGGTGGGG + Intronic
1051722761 9:20055595-20055617 TAGACATACCAGGCCAGGCGCGG + Intergenic
1052297870 9:26918416-26918438 TAGAATTATCAGGCCAGGTGTGG - Intronic
1052838435 9:33269682-33269704 GATATGTAGCAGGCCGGGTGCGG + Intronic
1052940577 9:34128910-34128932 AAAAGACTGCAGGCCAGGTGCGG + Intergenic
1052940636 9:34129558-34129580 AAAAGATATCAGGCCAGGCGTGG + Intergenic
1053143208 9:35694475-35694497 AATAGGTTTCAGGCCAGGTGCGG + Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053229886 9:36399642-36399664 TATAGATGTCAGATCAGGTGTGG - Intronic
1053394427 9:37760033-37760055 TAAAAATAATAGGCCAGGTGCGG + Intronic
1054799799 9:69335807-69335829 AAGAGAAAACAGGCCAGGTGTGG + Intronic
1056264517 9:84883055-84883077 TGTTTCTAGCAGGCCAGGTGTGG - Intronic
1056598980 9:88031219-88031241 AAGAGATAACAGGCCAGGCGTGG - Intergenic
1056942987 9:90971230-90971252 TAAAGAATGAAGGCCAGGTGTGG + Intergenic
1057249353 9:93487450-93487472 CTTAGAATGCAGGCCAGGTGCGG - Intronic
1057348678 9:94276065-94276087 AAGAGAGTGCAGGCCAGGTGTGG - Intronic
1057354472 9:94322416-94322438 GACAGATGGCAGGACAGGTGTGG - Intronic
1057596865 9:96422062-96422084 AAAACATAGCAGGCCAGGGGTGG + Intergenic
1057653289 9:96935219-96935241 GACAGATGGCAGGACAGGTGTGG + Intronic
1058554747 9:106155026-106155048 CATAGAGAGCAGGCCAAGAGAGG - Intergenic
1058802069 9:108554018-108554040 AATAGATGGCAGGTCAGGTTTGG - Intergenic
1058937004 9:109779058-109779080 TATACACATCAGGCCAGATGCGG - Intronic
1059075668 9:111191305-111191327 GATGAATAGGAGGCCAGGTGAGG + Intergenic
1059848986 9:118315580-118315602 TAAAGACAGCATGCCAGGAGAGG - Intergenic
1060129303 9:121079375-121079397 TACAGGTTGAAGGCCAGGTGTGG + Intronic
1060151003 9:121288216-121288238 GACAGAAAGCAGGCCAGGTGAGG - Intronic
1060163133 9:121385371-121385393 TAATGATTGCTGGCCAGGTGTGG + Intergenic
1060510938 9:124231750-124231772 TATAGAAAGAAAGCCAGGTGCGG + Intergenic
1060630940 9:125157977-125157999 TGTAGATTGCCGGCCGGGTGGGG - Intronic
1060657367 9:125381123-125381145 TCTGGAGAGCAGGCCAGCTGGGG + Intergenic
1061456319 9:130700647-130700669 TACAGACAGAAGGCCAGGTGCGG - Intronic
1061827057 9:133265044-133265066 TAAAAATAGAGGGCCAGGTGAGG - Intronic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1203572471 Un_KI270744v1:143956-143978 TATAAATAGCCGGCCGGGCGCGG - Intergenic
1185675523 X:1846008-1846030 TATAAATATCTGGCCAGGTGCGG - Intergenic
1185724666 X:2410019-2410041 TAAAGAAACCAGGCCGGGTGTGG - Intronic
1185791779 X:2932690-2932712 AAGAAATAGTAGGCCAGGTGCGG - Intergenic
1185828154 X:3272679-3272701 TACAAATAAGAGGCCAGGTGTGG - Intronic
1185953642 X:4464758-4464780 AATGGAATGCAGGCCAGGTGTGG + Intergenic
1186437473 X:9555367-9555389 AATAAAAAACAGGCCAGGTGTGG - Intronic
1186837463 X:13452022-13452044 TAAAGATTGACGGCCAGGTGTGG + Intergenic
1187137683 X:16563976-16563998 TATGTATAACAGGCCGGGTGTGG - Intergenic
1187164310 X:16790490-16790512 TAAAAAGATCAGGCCAGGTGTGG - Intronic
1187193591 X:17059759-17059781 TTTAGAAAACAGGCCAGGTGTGG - Intronic
1187368515 X:18684450-18684472 TATAGATAGCTGGTCTGGAGAGG - Intronic
1187503655 X:19861084-19861106 TAAAAACAGCAGGCCAGGCGCGG + Intronic
1187879514 X:23833689-23833711 TAGAGAAACCAGGCCAGGCGCGG + Intronic
1188414249 X:29913149-29913171 TTCTGAGAGCAGGCCAGGTGAGG - Intronic
1188472178 X:30553382-30553404 AATAAATAGTAGGCCGGGTGCGG + Intergenic
1188503074 X:30850420-30850442 GATAGATCGGGGGCCAGGTGCGG + Intronic
1188546108 X:31309017-31309039 AATAGATGGCAGTCCAGGCGTGG - Intronic
1189382932 X:40514601-40514623 TAAAGATACCAGGCCAGGCACGG + Intergenic
1189424846 X:40890210-40890232 GTAAGATAGAAGGCCAGGTGCGG + Intergenic
1189427658 X:40915790-40915812 TTTAGAAATCTGGCCAGGTGTGG - Intergenic
1189502897 X:41581086-41581108 TACAGATTTTAGGCCAGGTGTGG + Intronic
1190096795 X:47487796-47487818 TTTAAACAGCAGGCCAGGCGTGG - Intergenic
1190225738 X:48543523-48543545 TTCAAAAAGCAGGCCAGGTGCGG - Intronic
1190291345 X:48994512-48994534 TATTGCAAGCAGGCCGGGTGCGG - Intronic
1190819508 X:53960363-53960385 TAGAGAAATTAGGCCAGGTGCGG - Intronic
1190958667 X:55222907-55222929 CAGAGATAGAAGGCCAGGTGTGG + Intronic
1190964274 X:55283006-55283028 CAGAGATAGAGGGCCAGGTGTGG + Intronic
1192098997 X:68243676-68243698 TATATATAACAGGCCAGGCATGG - Intronic
1192240642 X:69325003-69325025 TATTCATAGCAGGGCAGGGGTGG - Intergenic
1192487676 X:71544074-71544096 TATATATATCAGGCCGGGCGTGG - Intronic
1193381370 X:80820182-80820204 ATTAAATAGCAGGCCAGGCGCGG + Intergenic
1193767128 X:85543342-85543364 TATAGGCAGCAGGCAAGGTGAGG + Intergenic
1194050909 X:89067893-89067915 TATAAATTTTAGGCCAGGTGCGG + Intergenic
1194619282 X:96149024-96149046 TACAGAAAGGGGGCCAGGTGCGG + Intergenic
1194864306 X:99047719-99047741 TAGAGAGAGCAAGCAAGGTGGGG + Intergenic
1195520841 X:105826708-105826730 TGTGGATAGCAGGCCTGGTCTGG - Intronic
1195660542 X:107373688-107373710 TATAGAAAGAAGGCTGGGTGTGG + Intergenic
1195777642 X:108425441-108425463 TATAGCTCTCAGGCCAGGCGTGG + Intronic
1195925089 X:110016945-110016967 TAGATAAAACAGGCCAGGTGTGG - Intronic
1195934154 X:110109225-110109247 TACATATAGCTGGCCAGGCGCGG + Intronic
1196229439 X:113203954-113203976 TATAAAAAGCAGGCTAGGTGTGG - Intergenic
1196556991 X:117100036-117100058 TATAATTAGTAGGCCAAGTGCGG + Intergenic
1197179544 X:123519730-123519752 TACAGATAGAAAGTCAGGTGTGG - Intergenic
1197770997 X:130089210-130089232 TCAAGTTAGAAGGCCAGGTGCGG + Intronic
1198077287 X:133205683-133205705 TTAAGAAAACAGGCCAGGTGCGG - Intergenic
1198544813 X:137680222-137680244 AATATATAACAGGCCAGGTGCGG + Intergenic
1198915654 X:141668607-141668629 TACAGATGGCAGGGCAGGAGAGG - Intronic
1199130888 X:144184958-144184980 TAGAGTTAAAAGGCCAGGTGTGG + Intergenic
1199615342 X:149651428-149651450 TATTGCCAGCAGGCAAGGTGAGG - Intergenic
1200166172 X:154036824-154036846 TATACAAAACAGGTCAGGTGTGG + Intronic
1201224249 Y:11802163-11802185 AAAAGAAATCAGGCCAGGTGCGG + Intergenic
1201316304 Y:12650235-12650257 TAAAGTTTGCTGGCCAGGTGTGG + Intergenic
1201525408 Y:14927497-14927519 AATAACTAGCAGGCCAGGTGTGG - Intergenic
1201965781 Y:19733579-19733601 TAAACATAAGAGGCCAGGTGCGG + Intronic
1202186311 Y:22187859-22187881 TATAATTTGAAGGCCAGGTGGGG + Intergenic
1202196514 Y:22303925-22303947 TATAATTTGAAGGCCAGGTGGGG - Intergenic
1202205048 Y:22398537-22398559 TATAATTTGAAGGCCAGGTGGGG - Intronic
1202580137 Y:26371824-26371846 AAAAGAAATCAGGCCAGGTGTGG + Intergenic