ID: 1076977855

View in Genome Browser
Species Human (GRCh38)
Location 11:189154-189176
Sequence ATTCAGTGGAAGGCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 7, 1: 31, 2: 67, 3: 71, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076977852_1076977855 -7 Left 1076977852 11:189138-189160 CCAGACTAAATTGTGTATTCAGT 0: 41
1: 63
2: 47
3: 40
4: 372
Right 1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG 0: 7
1: 31
2: 67
3: 71
4: 234
1076977850_1076977855 28 Left 1076977850 11:189103-189125 CCCTATTATTTATGTAAAAATGC 0: 7
1: 76
2: 87
3: 112
4: 587
Right 1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG 0: 7
1: 31
2: 67
3: 71
4: 234
1076977851_1076977855 27 Left 1076977851 11:189104-189126 CCTATTATTTATGTAAAAATGCA 0: 7
1: 71
2: 95
3: 126
4: 719
Right 1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG 0: 7
1: 31
2: 67
3: 71
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076977855 Original CRISPR ATTCAGTGGAAGGCTGATGA AGG Intronic
901270667 1:7951002-7951024 ATACATTGAAAGGCTGATAAAGG + Intergenic
901384906 1:8901639-8901661 ACACTGTGGGAGGCTGATGAGGG - Intergenic
902415970 1:16239454-16239476 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
903981093 1:27188827-27188849 ATCCTGTGGGAGGCTGAGGAGGG - Intergenic
904449887 1:30604319-30604341 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
904574947 1:31499443-31499465 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
905539292 1:38747225-38747247 ATTCACTGGAAGCTTGATGCTGG + Intergenic
906912084 1:49964260-49964282 ATTCAGTAAATGGCGGATGAAGG - Intronic
907179327 1:52555276-52555298 ATTCAGTGGAGTGCAGAGGAGGG - Intergenic
908226667 1:62062607-62062629 ATTACTTGGAAGGCTGATGTGGG - Intronic
912056085 1:105599540-105599562 ATTCAGTGGAAGGCTAATCAAGG - Intergenic
914703969 1:150156634-150156656 AATTAGAGGAAGTCTGATGAAGG - Intronic
915219402 1:154362294-154362316 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
915641438 1:157230196-157230218 ATTCAGGGGAAGGGTGAAGGTGG + Intergenic
916564499 1:165961701-165961723 ATTTAGTGGCAGGAAGATGAAGG - Intergenic
916989692 1:170229008-170229030 ATTCAGTGGAAGACTGATCAAGG - Intergenic
917461374 1:175233337-175233359 ATTGAATGGAAGTCTGTTGAGGG + Intergenic
917511251 1:175670991-175671013 ATTCAGGTGAAGGATGATGATGG + Intronic
917604146 1:176608910-176608932 TTTCAGTGGAGGGATGATCAGGG + Intronic
917670519 1:177269424-177269446 ATTTAGTTGAAGGCTGAGGAAGG + Intronic
917734627 1:177909176-177909198 ATTCAGTAAATGGTTGATGAAGG + Intergenic
917920930 1:179749208-179749230 ACCAAGTGGAGGGCTGATGATGG + Intronic
918579120 1:186104420-186104442 ATTCAGAGGAATGATGATTATGG - Intronic
918951791 1:191150005-191150027 GTTCAGTGGAAGGCTGATCAGGG + Intergenic
920362901 1:205431569-205431591 ATTGAGTGGAAGGTTGGTGGAGG + Intronic
922847873 1:228704107-228704129 ATCCAGTGGAAGGCTCATCAAGG + Intergenic
923246955 1:232141447-232141469 ATTCTGTGGATGGATGATGCTGG + Intergenic
924712931 1:246545564-246545586 ATTCATTGGGAGGCTGAGGTGGG + Intronic
924853698 1:247855972-247855994 ATCCAGTGGAAGGCTGAATCAGG - Intergenic
1065736007 10:28753087-28753109 GTTCAGGGGAAGGATGATGGTGG + Intergenic
1067776721 10:49169783-49169805 ATTCAATGGAAGGCTGTGGGTGG + Intronic
1068904898 10:62311759-62311781 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1069301980 10:66919378-66919400 CTTCAGTGGCAGACTTATGAAGG - Intronic
1072174004 10:92897739-92897761 ATTCAGTGGAAGGCTGATCAAGG + Intronic
1072342868 10:94472066-94472088 ATTCAGTGAAAGGCTCATCGGGG - Intronic
1072357115 10:94622715-94622737 ATTCTGTGGAAGGCTGATCAAGG - Intergenic
1075688106 10:124377921-124377943 ATGAAGTGGAATGCTGATGATGG + Intergenic
1075975510 10:126690677-126690699 ATTCAGTGGAAGGCTGGTCAAGG - Intergenic
1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG + Intronic
1077262697 11:1631263-1631285 CTTCAGCGGAAGGATGAGGAAGG + Intergenic
1079640949 11:22804771-22804793 AGTCATTGGTAGGCTGATGGAGG + Intronic
1080277954 11:30524139-30524161 ACTCAGTGGGAGGCTGAGGCAGG + Intronic
1081529767 11:43950085-43950107 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1082192935 11:49269086-49269108 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1082736805 11:56865201-56865223 ATTCAGAAGAGGGCTGATCAAGG + Intergenic
1082737430 11:56872450-56872472 ATATAGTGGAAGGCTGATCAAGG + Intergenic
1083352870 11:62043497-62043519 CTTCAGTGGAAGGCTGATCAAGG + Intergenic
1083383451 11:62288295-62288317 ATTCAGTAGAAGGCTAATCAAGG - Intergenic
1084854975 11:71977753-71977775 ATTCAGTGGAAAGATGAGGCAGG - Intronic
1085251525 11:75147288-75147310 AATCAGGGGAAGGCTGCTGTGGG + Intronic
1085407325 11:76271036-76271058 AGTGATTGGAAGGCTGATGATGG + Intergenic
1086365263 11:86102889-86102911 ATTGAATGGACAGCTGATGAGGG - Intergenic
1086673196 11:89571988-89572010 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
1087037551 11:93770352-93770374 ATTCAGTGGAAGGCTGATCAAGG + Intronic
1088594515 11:111430354-111430376 ATTCAGTGGAAGGCTAGTCAAGG - Intronic
1089827883 11:121295396-121295418 ATTCAGTGGAAGGCTAATCAAGG - Intronic
1089895892 11:121929690-121929712 TTTCAGTGGAATTCTGATCATGG + Intergenic
1092057551 12:5520533-5520555 TTTCAGTGGAAGGGTGGGGAGGG + Intronic
1092617425 12:10228097-10228119 ATTCAGTAAAAGAATGATGATGG + Intergenic
1093057639 12:14570514-14570536 ATTCTGTGGAAGGCTGATCAAGG + Intergenic
1094097286 12:26721017-26721039 ATTCAGTGGAGGGCTGGGGATGG + Intronic
1094614488 12:32023848-32023870 ATTCAGTGGAAAGATGATCAAGG - Intergenic
1095828940 12:46562107-46562129 ATTCAGTGAAAGGCTGATGAAGG + Intergenic
1095979116 12:47960756-47960778 ATTCAATGGAAGGCGGATGTAGG - Intergenic
1096084017 12:48852941-48852963 ACTCAGTGGAAGACTGAAGTAGG - Intergenic
1096793883 12:54061910-54061932 CTTCAGTGGAAGAGAGATGAAGG - Intergenic
1096904744 12:54925085-54925107 ATTCGGTGGAAGGCTGATCAAGG - Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098236733 12:68424792-68424814 ATTCAGGGGTAAGGTGATGAAGG - Intergenic
1098700125 12:73613624-73613646 ATTCAGTGAAAGGCTCATCAAGG - Intergenic
1098900650 12:76108794-76108816 ATACTGTGGGAGGCTGATGTGGG + Intergenic
1098947734 12:76607036-76607058 CTGCAGTGGAGGGCTGATGGAGG + Intergenic
1100151269 12:91740939-91740961 AGGCAGTGGAAGGCTGAGAAAGG + Intergenic
1100380475 12:94057157-94057179 ATAGAATGGAAGGCTGGTGAGGG - Intergenic
1100809991 12:98328114-98328136 ATTCACTGGGAGGCCGAGGAGGG + Intergenic
1102700440 12:114834617-114834639 ATTCAGTGGGAGCCTCATGGGGG + Intergenic
1106186575 13:27415031-27415053 ATGCAGTGGAAGGGTGACAAAGG + Intergenic
1106793414 13:33179834-33179856 ATTCAGAAGAAGGCAGAAGAAGG + Intronic
1107003068 13:35573964-35573986 ATTAAGTAGAAGGATAATGATGG - Intronic
1107174583 13:37385500-37385522 ATTCAGCGGAAGGCTGATCAAGG + Intergenic
1108271657 13:48766982-48767004 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1108607238 13:52052013-52052035 ATTCAGTGAAAGGCTGATCAAGG + Intronic
1108807459 13:54176427-54176449 ATGCAGTGGAAGGAAGATAAAGG - Intergenic
1109422375 13:62130805-62130827 ATTCAGTGGAAAGCTGATCAAGG + Intergenic
1109960450 13:69621988-69622010 ATTCAGCGAAAGGCTGATCAAGG + Intergenic
1110267724 13:73557479-73557501 ATTCAGAGAAAGGCTGAGGCGGG - Intergenic
1110605447 13:77426883-77426905 ATTCAGTGGAAGGCTGACCAAGG + Intergenic
1110965154 13:81685490-81685512 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1111368616 13:87285497-87285519 ATTCAGTAGAAGGCTGATCAAGG + Intergenic
1111682197 13:91457810-91457832 GTACAGTGGAAGGCTGAAGGTGG + Intronic
1111787712 13:92811272-92811294 AATTGGTGCAAGGCTGATGATGG - Intronic
1111866013 13:93769719-93769741 ATTAAGTGGAAGGCAGAAGTTGG + Intronic
1112767496 13:102761235-102761257 CTTCAGTGGAATGCTAATTAGGG - Intergenic
1113316258 13:109182526-109182548 CTTCATTGGAAGGCTAAGGAAGG - Intronic
1113976704 13:114232831-114232853 CATCAGTAGAAGTCTGATGATGG - Intergenic
1115446069 14:33491417-33491439 ATCCAGTGGAAATTTGATGATGG + Intronic
1115718871 14:36137520-36137542 ATCCAGTTGCAGGGTGATGATGG + Intergenic
1115859251 14:37666217-37666239 AGTCAGGTGAAGGCTGATGGAGG - Intronic
1116987714 14:51239099-51239121 ATTCAGTGGAGGGGTGGGGAAGG + Intergenic
1117398410 14:55335061-55335083 ATTGAGTGGAGGGCAGGTGAAGG + Intronic
1117926878 14:60790427-60790449 ATTCAGTGGAAGGCTGATCAAGG + Intronic
1118468289 14:66051898-66051920 AGGCAGTGGAGGGCTAATGAAGG - Intergenic
1118577407 14:67257169-67257191 ATTCAGTGAAAGACTGATCAAGG - Intronic
1119605614 14:76013682-76013704 AGCCAGCAGAAGGCTGATGAAGG + Intronic
1119650578 14:76380181-76380203 ATTCAGCAGAGGGCTGAGGAAGG - Intronic
1120554272 14:85909202-85909224 ATTCAGTGGGAGACAGATGGGGG - Intergenic
1121856217 14:97272492-97272514 ATACCGTGGAAGGCTGAAGGTGG + Intergenic
1123146362 14:106134504-106134526 ATTCAGTGGTAGGCTGATAAAGG - Intergenic
1123872333 15:24589494-24589516 ATTCAGTAGAAGGCTGATCAAGG - Intergenic
1123883322 15:24696350-24696372 ATTCAGTGAAAGGCTGACCAAGG - Intergenic
1125039428 15:35166794-35166816 TCTCAGTAGCAGGCTGATGATGG - Intergenic
1125381137 15:39088285-39088307 ATTCATGGGAAAGCAGATGATGG + Intergenic
1125507334 15:40274350-40274372 CTTCAGTGGAAGGGAGATGCTGG - Intronic
1125607430 15:40949074-40949096 AAACAGTGGAAGGCTGTTGTAGG - Intergenic
1126370033 15:47935804-47935826 GGTCAGTGGAAGGTTTATGATGG + Intergenic
1127102137 15:55577218-55577240 ATTCAGTGAAAGGCTGATCAAGG + Intronic
1127214349 15:56809043-56809065 ATTCACTGGAAGAATGTTGAAGG - Intronic
1127229062 15:56968955-56968977 ATTCAGTGGAAGGCTAACCAAGG - Intronic
1128268180 15:66285453-66285475 ATTCAGTCAAAGGCTAATGTAGG + Intergenic
1131547547 15:93328577-93328599 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
1133841178 16:9411118-9411140 GTTCAGTGGACGGCTGATCAAGG - Intergenic
1134340565 16:13341333-13341355 ATTCAATGAAAGGATGTTGAGGG - Intergenic
1134369558 16:13610393-13610415 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1134371718 16:13632149-13632171 ATTCGGTGGAAGGCTGGTCAAGG + Intergenic
1136105539 16:28027415-28027437 TTTCAGTGCAGGGCTTATGAGGG + Intronic
1136692702 16:32046962-32046984 ATTCAGTGGTAGGCTGATAAAGG + Intergenic
1136793199 16:32990188-32990210 ATTCAGTGGTAGGCTGATAAAGG + Intergenic
1136876654 16:33863869-33863891 ATTCAGTGGTAGGCTGATAAAGG - Intergenic
1137631753 16:49951391-49951413 ATTCAGAGGAAGCTGGATGAAGG + Intergenic
1138263160 16:55640141-55640163 ATTCATTGAAAGGCAGATGCTGG - Intergenic
1139086420 16:63592122-63592144 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1142442477 16:90108179-90108201 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1203095455 16_KI270728v1_random:1251879-1251901 ATTCAGTGGTAGGCTGATAAAGG + Intergenic
1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1143467246 17:7145754-7145776 GTTCAGTGAAAGGCTGATCAAGG + Intergenic
1145223148 17:21105638-21105660 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1146322495 17:31858091-31858113 TCTCAGTGGAGGGCTGTTGAAGG - Intronic
1148096407 17:45055485-45055507 ATTCAGTGGGAGGCTGAGATGGG - Intronic
1149354197 17:55822842-55822864 ATTGAGTGGAAGGAAGAGGAAGG + Intronic
1149856531 17:60087913-60087935 AGTCAGAGGGTGGCTGATGAGGG + Intergenic
1151085465 17:71375519-71375541 ATTCAATGGTAAACTGATGAAGG + Intergenic
1153851539 18:9099941-9099963 ATTCAGTGGAGGGCTGATCAAGG - Intergenic
1154358881 18:13642695-13642717 ATTCAGTGGCCGCCCGATGAGGG - Intronic
1155377506 18:25176582-25176604 CTTCGCTGGAATGCTGATGAAGG + Intronic
1156078919 18:33312231-33312253 ATCCAGTGGAAGGCAGAAAAAGG - Intronic
1156395708 18:36698030-36698052 ATGCAGTGTTAGGCTGATGATGG - Intronic
1157530307 18:48414728-48414750 ATTCAGGGGAAGGAAGATGAAGG - Intergenic
1158131247 18:54154771-54154793 AATCAGAGGAAGGCTAACGAGGG + Exonic
1159038873 18:63304098-63304120 ATGCAGTGCAAGGGTGCTGATGG - Intronic
1159490442 18:69126965-69126987 ATTCAATGGAAAGATGATAAAGG + Intergenic
1160720530 19:595243-595265 AGTGAGTGGGGGGCTGATGAAGG - Intronic
1163555488 19:17989997-17990019 CTTCAGAGGGAGGCAGATGATGG + Intronic
1164078011 19:21837980-21838002 ATTCAGTTGAATGCTTATCAAGG - Intronic
1164203945 19:23042282-23042304 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1164314707 19:24077117-24077139 ATTCAGTGGGAGACTTATCAAGG + Intronic
1165709706 19:38002127-38002149 GTTCTGTGGATGGATGATGATGG - Intronic
1167291494 19:48627606-48627628 ATTCCGTTGGGGGCTGATGAAGG + Intronic
1167442156 19:49514565-49514587 CTGCAGTGGGAGGCTGATGGAGG - Intronic
1167968207 19:53166170-53166192 TGTCAGTGGAAAGATGATGAAGG - Exonic
925272678 2:2624587-2624609 TTTTAGTGAAAGGCTGATCAAGG - Intergenic
925308118 2:2864554-2864576 ATTCAGTGGAAAGGTGATCAAGG + Intergenic
925449506 2:3956798-3956820 ATTCCGTGGAACCCTGAGGAGGG + Intergenic
926208427 2:10850476-10850498 ATTCAGTGAAAGGCTAATCAAGG + Intronic
926250168 2:11151077-11151099 ATTCACTGAAAGGCTGATCAAGG + Intergenic
926269262 2:11352851-11352873 AGTCAGTGGAAAGCAGATGAGGG + Intergenic
926521390 2:13919798-13919820 ATTCAGTGCAAGGCTGACGAAGG + Intergenic
927701237 2:25270223-25270245 ATTTAGGGGAGGGCTGAGGAAGG - Intronic
928956631 2:36876020-36876042 ATTTAGTGGGAGGCTGAGGCAGG + Intronic
929665196 2:43828387-43828409 ATACTTTGGAAGGCTGAGGAGGG + Intronic
929748613 2:44686060-44686082 ATTCAGATGAGAGCTGATGAAGG - Intronic
930082614 2:47465724-47465746 ATTCAGTGAAAGGCTGATCAAGG - Intronic
932727553 2:74192591-74192613 ATTCAGTGAAACGCTGATCAAGG - Intergenic
932749445 2:74362050-74362072 ACCCTGAGGAAGGCTGATGAAGG + Exonic
932834257 2:75020631-75020653 AATCAGTGGAAGGCTGCTGAGGG - Intergenic
933521217 2:83376770-83376792 ATTCAGTAGATGGCAGGTGATGG - Intergenic
933611629 2:84442793-84442815 ATTAAGTGGCAGGCTTAGGATGG - Intronic
933613671 2:84462266-84462288 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
934887057 2:98034137-98034159 ATTCATTGAAAGGCTGATCAAGG + Intergenic
935802710 2:106714675-106714697 ATTTAGTGGAAGGGTGGTGGTGG + Intergenic
935983906 2:108653902-108653924 ATTCATCGGAAGGCTGATCAAGG - Intronic
936115736 2:109701526-109701548 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
936136339 2:109897556-109897578 ATTCATCGGAAGGCTGATCAAGG - Intergenic
936208358 2:110473929-110473951 ATTCATCGGAAGGCTGATCAAGG + Intergenic
937631582 2:124107980-124108002 ATTCAGTGAAAGGTAGATCAAGG - Intronic
937771120 2:125721712-125721734 ACTCTGTGGCAGGCTGATAATGG + Intergenic
939601646 2:144199337-144199359 GTTCAGTAGAAGGCTGAGCACGG - Intronic
940591162 2:155729549-155729571 ATTCAGAGGAAGGCTGAGGCTGG - Intergenic
941512643 2:166432331-166432353 ATTCAGAGTAAGTCTGGTGATGG - Exonic
942316214 2:174698811-174698833 ACTCAGTGGAAGGCTGATCAAGG + Intergenic
942978142 2:182044106-182044128 ATTCAGGTGATGGATGATGAAGG - Intronic
943598200 2:189882553-189882575 ATTCAATGAAAGGCTGATCAAGG - Intronic
945117384 2:206421432-206421454 ATTCAGTGGCAGGCAGAAGCTGG - Intergenic
945292899 2:208143455-208143477 ATTCAGTGGAAAGCTGATCAAGG + Intronic
945434511 2:209803305-209803327 AGTCAGTGGAAGGCTAATATAGG - Intronic
945579318 2:211572938-211572960 ATTGTGTGGTAGGCTGATGATGG + Intronic
946000779 2:216480508-216480530 ATTCAGAAAGAGGCTGATGAGGG + Intronic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
946702793 2:222429297-222429319 ATTCAGTAGGAGGGTGGTGATGG + Intronic
947053759 2:226076669-226076691 ATTCAGTCAAAGCATGATGAAGG - Intergenic
1169178727 20:3543028-3543050 AACCAGTGAAAGCCTGATGATGG + Intronic
1169443431 20:5652050-5652072 ATTCAGCGAAAGGCTGATCAGGG + Intergenic
1170070810 20:12364531-12364553 ATTCAGTAGGATGTTGATGATGG - Intergenic
1174661029 20:52213325-52213347 ATTTAGTGGAAGGCTGATCAAGG - Intergenic
1175337112 20:58203846-58203868 ATGCTGTGGAAGGCTGAAAATGG + Intergenic
1177051119 21:16235258-16235280 ATTCAGGGGAATGAGGATGATGG - Intergenic
1177649572 21:23942926-23942948 CTTCAGTGGAAGGCTAATCAAGG - Intergenic
1178448281 21:32665501-32665523 ATTCAGTGGAAGGCTGATCTAGG + Intronic
1178600633 21:33991494-33991516 AGGCAGGGGAAGGCTGATGGTGG + Intergenic
1179668359 21:42927924-42927946 ATTCAGTGGAAGGCTGACCAAGG - Intergenic
1179672169 21:42957277-42957299 ATTCAGTGAAAGGCTGTTCAAGG + Intergenic
1181148874 22:20868672-20868694 ATTCAGAGGAAGGCAGCTGAGGG + Intronic
1182588724 22:31362691-31362713 ATTCAGGGAAAAGCTGATCAAGG - Intergenic
1184102170 22:42346644-42346666 TTTCACTGGAAAGCTGGTGAGGG - Intergenic
1184588993 22:45468467-45468489 ATTCAGTGGAAGACTGGTCAAGG + Intergenic
949176614 3:1070961-1070983 GCTCAGTGGACAGCTGATGAAGG + Intergenic
949493837 3:4613221-4613243 ATTTAGTGGAAGACTGACAAAGG - Intronic
950220454 3:11191457-11191479 TGTTAGTGGAAGGCTGAAGATGG + Intronic
950467754 3:13165397-13165419 ATTCCCAGGAAGCCTGATGATGG + Intergenic
952712330 3:36443942-36443964 ATACAGTGACAGGCTGATGCAGG - Intronic
953755669 3:45643791-45643813 GCTCAGTGGAAGGCTGCAGAGGG + Intronic
954544558 3:51421744-51421766 ATTAAGAGCAAGGCTGATCAGGG - Intronic
957135090 3:76277115-76277137 ATCCACTGGAATGCTTATGATGG - Intronic
957440638 3:80242315-80242337 ATTCAGTGAAAGGCTAATCAAGG + Intergenic
961182810 3:124889280-124889302 ATTCAGTGGAAGGCTGATCAAGG + Intronic
961704194 3:128771624-128771646 ATTTAGTAGAAGGCTGAAGGAGG + Intronic
962388393 3:134951697-134951719 CTTTGGGGGAAGGCTGATGAAGG + Exonic
962554198 3:136529412-136529434 ATTTACTGGTAGTCTGATGAAGG - Intronic
962833275 3:139162707-139162729 TTTTAGTGGAAGGCTGATCAAGG - Intronic
963299780 3:143585369-143585391 ATTCAGTGGAAGGCTGATCAAGG + Intronic
964311607 3:155399733-155399755 ATTCAGTTGCAGCCAGATGATGG + Intronic
964956497 3:162364872-162364894 ATTCAGTACATGGCTAATGAGGG + Intergenic
966826838 3:183972019-183972041 ATACAGTGGAAGGAAGCTGAAGG + Intronic
966958223 3:184907228-184907250 ATTCAGTGGAAGGTTGATCAAGG - Intronic
967116949 3:186350178-186350200 GTTCTGTGGAAGGCTGAGCATGG - Intronic
967279055 3:187804873-187804895 ATTCAGTGGGGGGCTGGTGAGGG - Intergenic
967635399 3:191796103-191796125 ACACATTGGAAGGCTGATGTTGG + Intergenic
968270550 3:197399995-197400017 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
968362750 3:198159139-198159161 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
968722997 4:2221522-2221544 ATTCAGTGGAAGGCTGATCAAGG + Intronic
969422529 4:7105593-7105615 AGTCAGGGGAAGGCTCATGGTGG - Intergenic
969450985 4:7273260-7273282 TGTCAATGGAAGGCTGAGGAAGG + Intronic
969655366 4:8494478-8494500 ATTCAGTGAAAGACTGATCGAGG + Intergenic
970271371 4:14351504-14351526 ATTCCGTGGAAGACTTATCAAGG - Intergenic
972565620 4:40266566-40266588 ATTCAGTGGAAGGTTGATCAAGG - Intergenic
973280688 4:48357943-48357965 ATACTGTGGAAGGCTGAGGTGGG - Intronic
973911702 4:55588379-55588401 ATTCAGTGGAAGGCTAATCAAGG + Intronic
974082799 4:57230309-57230331 ATTTAGTGGAAGGCTGATCAAGG - Intergenic
974609940 4:64204530-64204552 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
974773498 4:66447843-66447865 ATTTAATGCAAGGCTGATGTAGG + Intergenic
976695920 4:87919579-87919601 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
977348998 4:95856556-95856578 CTTCAGTGAAAGGCTGATCAAGG - Intergenic
977894319 4:102346313-102346335 ATTGAGTGGAAGGCTGATCATGG + Intronic
978529387 4:109698920-109698942 ATTCAGTGGAAGGCTGTCCAGGG - Intronic
978598673 4:110405577-110405599 ATTCAGTGAAAGGCTGATCAAGG + Intronic
978705973 4:111711798-111711820 ATTCTATGGAAAACTGATGAGGG - Intergenic
980121594 4:128733652-128733674 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
980329262 4:131389513-131389535 ATTCAGTGGAACCCTGTAGATGG + Intergenic
980983949 4:139677451-139677473 ATTCAGTGAAAGGCTTATCAAGG - Intronic
981326754 4:143456928-143456950 ATTAAGTGAAAGGAAGATGATGG + Intronic
981761810 4:148202782-148202804 ATACAGAGGAAGGGGGATGAGGG - Intronic
983026500 4:162743869-162743891 ACTCAGTGGGAGGCTGAGGCAGG + Intergenic
983341001 4:166460805-166460827 ATTAAATGGAAAGCTGAAGAGGG - Intergenic
983639864 4:169935159-169935181 TTTCAGTGAAAGGCTGATCAAGG + Intergenic
983819349 4:172173362-172173384 ATTCACAGGAAGGCTCTTGATGG - Intronic
984250767 4:177332040-177332062 ACTCAGTGGGAGGCTTATGATGG + Intronic
984261687 4:177450579-177450601 ATTAAATGGAAGGCTGAGGCAGG + Intergenic
984575789 4:181446772-181446794 ATTCAGGGGAATGCTGATGATGG - Intergenic
986163655 5:5253384-5253406 ATTCAGTGGAAGGCTGATCAAGG - Intronic
986631699 5:9780310-9780332 GTGCAGTGGAGGGCTGGTGATGG - Intergenic
986636995 5:9833072-9833094 ATTCAGTGCAAGGCTGATAGAGG - Intergenic
987961917 5:24822011-24822033 CTTCAGTGGCAGACTGATGCTGG + Intergenic
988444590 5:31271417-31271439 ACGCAGTGGAAGGCTGAGGAAGG - Intronic
989256050 5:39366720-39366742 AATCAATGGAAGGGGGATGAGGG + Intronic
990290191 5:54342109-54342131 TTTCAGTGAAAGTATGATGATGG + Intergenic
991175717 5:63685696-63685718 ATTCAGTGGAAGGCTGATCTAGG + Intergenic
991264907 5:64706265-64706287 ATTTAGTGGAAGGCTGATCAAGG - Intronic
993500033 5:88655593-88655615 ATACAGTGGAATGCTTATGAAGG - Intergenic
993551307 5:89277257-89277279 GTTGAGAGGAAGGCTGAAGAAGG - Intergenic
994061275 5:95480221-95480243 ATTCTGATGAAGTCTGATGATGG - Intronic
994428539 5:99626538-99626560 TTTCAGTGGAAATCTTATGACGG - Intergenic
995594996 5:113738560-113738582 ATTTGGTGGAAGGCTAAAGATGG + Intergenic
997527938 5:134565493-134565515 ATCAAGAGAAAGGCTGATGATGG - Intronic
998442955 5:142177460-142177482 ACTCCTTGGAAGGCTGAGGAGGG - Intergenic
999450434 5:151673623-151673645 ATTCAGGGGAAGGCTGATCAAGG + Intronic
999503601 5:152171664-152171686 ATTCATTGGAATGCTAATCAAGG - Intergenic
999544059 5:152607217-152607239 CTTCAATGAAAGGCTGATGTGGG - Intergenic
999925450 5:156370898-156370920 ATTCTGTGGGAGGCTGAGGGAGG + Intronic
1000052927 5:157577484-157577506 ATTCAGTGGAAGGTTGATCAAGG - Intergenic
1000174530 5:158737825-158737847 ACTCGGAGGAAGACTGATGAGGG + Intronic
1001712165 5:173787545-173787567 ATTGAGTGGAGGGCAGATGAGGG + Intergenic
1002154222 5:177262962-177262984 ATTCAGTGAAAGGCTGATGAAGG + Intronic
1003001489 6:2338906-2338928 ATTCAGTGGAAAGCTGATCGAGG - Intergenic
1005026439 6:21466986-21467008 AGACAGTTGAAGGATGATGAAGG - Intergenic
1005615469 6:27568364-27568386 TTTCAGCGGAAGGCTTATCAAGG + Intergenic
1005624344 6:27649264-27649286 ATTCAGTGAAAGGTTGATCAAGG + Intergenic
1007156333 6:39748275-39748297 GTTCAGTGGAAGGCTGATCAAGG - Intergenic
1007413071 6:41675959-41675981 AGGCAGTGGAAGGCAGAGGAGGG - Intergenic
1009026443 6:58006139-58006161 TTTGATTGGAAGGCAGATGAAGG + Intergenic
1009201994 6:60757612-60757634 TTTGATTGGAAGGCAGATGAAGG + Intergenic
1009338448 6:62524038-62524060 ATTTAGTGGAAGGCAGGAGAAGG - Intergenic
1010318479 6:74478358-74478380 ATTCAGTGAGATGATGATGATGG - Intergenic
1010621701 6:78085118-78085140 CCTCAGTGGAAGGCTAATTATGG - Intergenic
1010622159 6:78090026-78090048 ATTCAGTGGAAGGCTGGTCAAGG + Intergenic
1010815265 6:80351357-80351379 ACTCAGTTTAAGGGTGATGAGGG + Intergenic
1012064551 6:94534038-94534060 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1012064566 6:94534206-94534228 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1012946812 6:105475060-105475082 CATCAGTGGAAGCCAGATGATGG - Intergenic
1012991703 6:105932973-105932995 AATCAGTGTACGGATGATGATGG + Intergenic
1014376657 6:120683829-120683851 ACTCAGGGGAAGGCTGGGGAGGG + Intergenic
1014400279 6:120980593-120980615 ATTCAGTTGAAGGCTGAGGCAGG + Intergenic
1014726837 6:124981527-124981549 ATTCAGTGAATGGCTGATCAAGG - Intronic
1015189264 6:130455532-130455554 ATTTAGTGTAAGGCCGATCAAGG - Intergenic
1016211467 6:141539872-141539894 ATTCAGTGAAAGGCCAATCAAGG + Intergenic
1016315423 6:142780350-142780372 CTTCAGTGAAAGGCTTATTAGGG + Intronic
1017404283 6:154101144-154101166 ATTCAGTGAAAGGTGGATGTGGG + Intronic
1019001295 6:168755133-168755155 ATTCAAAGGAAGGAAGATGAGGG + Intergenic
1019099827 6:169620505-169620527 ATTCAGTGGAAAGCTGATCAAGG + Intronic
1019233303 6:170586483-170586505 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1020748228 7:12105786-12105808 ATTAAGTAAAAGGCAGATGATGG - Intergenic
1021251125 7:18326843-18326865 ATTCAGGGGAGAACTGATGATGG + Intronic
1023736007 7:43236612-43236634 ATTCAGCGAAAGGCTGATCAAGG - Intronic
1023934055 7:44726543-44726565 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1024589835 7:50871772-50871794 ATTCAGGGAAAGGCTGATCAAGG - Intergenic
1025849242 7:65232332-65232354 ATTCAGTGAAGGGCTTATCAAGG - Intergenic
1026291615 7:69011538-69011560 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1026561862 7:71457001-71457023 ATTCAGTGGAAGGTTAATCAAGG - Intronic
1026828569 7:73598118-73598140 AGTTAGTGGATGGATGATGAAGG - Intronic
1030273254 7:107692684-107692706 AGTCAGTGGAAGTCAGATGGGGG - Intronic
1030909214 7:115225851-115225873 ATAGAGTGGAAGGCTGCTGATGG + Intergenic
1030927437 7:115476269-115476291 TTACACTGGAAGGCTGTTGAGGG - Intergenic
1031197974 7:118640748-118640770 ATTCAGTGGGAGGCTGATTAAGG + Intergenic
1031621699 7:123941453-123941475 ATTCAATGGAAAGCTGATCAAGG - Intronic
1031622126 7:123946727-123946749 ATGCAGTGGAAGGCTGATCAAGG - Intronic
1032801308 7:135319288-135319310 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1034626861 7:152500204-152500226 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG + Intronic
1036146149 8:6256686-6256708 ATTCACTGAAAGACTGATGAGGG - Intergenic
1036291426 8:7495914-7495936 CATCAGTGGAGAGCTGATGAAGG - Exonic
1036330063 8:7815626-7815648 CATCAGTGGAGAGCTGATGAAGG + Exonic
1036648931 8:10629809-10629831 AGTCAGAGGAAGGCTGCTGTGGG + Intronic
1036737021 8:11329145-11329167 AATCACTGGAAGGCTGAGGCAGG + Intergenic
1039228546 8:35417909-35417931 AATCAGTGGAGGGGAGATGATGG + Intronic
1039424620 8:37475876-37475898 GTTCAGGGGAAGGCAGGTGAGGG + Intergenic
1039500831 8:38015475-38015497 ATTCAGTGAAAGACTGGTCAAGG - Intergenic
1039761709 8:40583839-40583861 ATTTAGTGGGAGGCCGATCAAGG - Intronic
1039952988 8:42186390-42186412 GTTCAGTGAAAAGCTGATCAAGG + Intronic
1040835518 8:51726406-51726428 ATTCATTGAAAGGCCCATGATGG + Intronic
1040925637 8:52679467-52679489 ATTGAGTGAAAGGCTGATCAAGG + Intronic
1041877671 8:62709207-62709229 ATTCAGTATAAGGGTGATGCTGG + Intronic
1042612441 8:70613870-70613892 ATTTAGGGGTAGGCTGATAATGG + Intronic
1044057374 8:87587884-87587906 ATTCAGGGAAAAGCTGATCAAGG - Intronic
1044069042 8:87733117-87733139 ATTAAGTGGAATGTAGATGATGG + Intergenic
1045555250 8:103209002-103209024 ATTCAGTGGATGGCTCAGTAGGG + Intronic
1047091871 8:121583985-121584007 ATTCAGCGGAAGGCTGATCAAGG + Intergenic
1047110990 8:121789405-121789427 GTTCAGTGGAAGGCTGATCAAGG + Intergenic
1047136081 8:122079859-122079881 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1047245937 8:123144711-123144733 ATTTAGTGGAAGGAAGCTGAAGG + Exonic
1050899022 9:10921293-10921315 CTTCAGTTTAGGGCTGATGAGGG + Intergenic
1051876215 9:21796561-21796583 ATGCAGTGGAAGGCCGATCGTGG - Intergenic
1052369054 9:27644222-27644244 ATTCTCAGGATGGCTGATGAGGG + Intergenic
1052958130 9:34270743-34270765 ATTAAGTGGTAGGCTGATGGTGG - Intronic
1053058842 9:35012580-35012602 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1053060581 9:35027939-35027961 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1053803185 9:41776946-41776968 TTTCAGTGGGAGGCCGATCAAGG - Intergenic
1054142076 9:61538178-61538200 TTTCAGTGGGAGGCCGATCACGG + Intergenic
1054191477 9:61988256-61988278 TTTCAGTGGGAGGCCGATCAAGG - Intergenic
1054646892 9:67599456-67599478 TTTCAGTGGGAGGCCGATCAAGG + Intergenic
1055054305 9:72010141-72010163 ATTCAGTGGAAAGCTGATCAAGG - Intergenic
1055334264 9:75217143-75217165 ATTCACTGGAAGGATGAAGCAGG - Intergenic
1055562233 9:77532429-77532451 ATGCAGGGGAAGGTAGATGATGG + Intronic
1056506929 9:87266240-87266262 CTTGAGAGGAAGGCTGAAGAAGG - Intergenic
1057229402 9:93310543-93310565 GTTCAGTGGATGGATGGTGATGG - Intronic
1060829482 9:126704665-126704687 AACGAGTGGCAGGCTGATGATGG + Intergenic
1061259200 9:129470307-129470329 ATTCATTGGGAGGCTGAGGCGGG + Intergenic
1062258055 9:135640057-135640079 AATCACTGGAAGGCTGAGGTGGG - Intergenic
1062747437 9:138222802-138222824 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1185729271 X:2447946-2447968 ATGCTATGGAAGGCTGAGGAAGG + Intronic
1185729939 X:2453285-2453307 ATGCTATGGAAGGCTGAGGAAGG + Intronic
1185730662 X:2458749-2458771 ATGCTATGGAAGGCTGAGGAAGG + Intronic
1185733607 X:2480433-2480455 ATGCTATGGAAGGCTGAGGAAGG + Intronic
1185804952 X:3048490-3048512 ATTCAGTGGAAAGCTGATCAAGG + Intronic
1185917199 X:4048509-4048531 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1185989428 X:4876459-4876481 ATTCAGTGGAAAGAGGAAGAGGG + Intergenic
1186642107 X:11466865-11466887 TTTCTGTGGAAGGCTGGTGTGGG - Intronic
1186737411 X:12480194-12480216 AATCAGAGGAAGGCTGGTGGTGG + Intronic
1186858531 X:13648723-13648745 ATTTAGTGGAGGAATGATGAAGG - Intergenic
1187026816 X:15444551-15444573 ATTCAGTGGAAGTCAAATGTAGG - Intronic
1188430675 X:30103251-30103273 ATTCAATAGAAGGCTGATCAAGG - Intergenic
1189704602 X:43747504-43747526 TCTCAGGGGGAGGCTGATGAAGG - Intergenic
1190951805 X:55152976-55152998 ATTCAGTGAAAGGCAGATCAAGG + Intronic
1193179655 X:78439843-78439865 ATTCAGTGGAAGGGTGATTAAGG + Intergenic
1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1193319713 X:80107026-80107048 ATTCTGTGGAAGGCTGATCAAGG + Intergenic
1193346963 X:80414672-80414694 ATTCAGTGGAAGGCTGATCAAGG - Intronic
1193639869 X:84000055-84000077 ACTCAGTGAAAGGCTGATCAAGG - Intergenic
1194113865 X:89872508-89872530 ATTCAGTGGAAGGCTGAACAAGG - Intergenic
1194363225 X:92980874-92980896 ATTGAGTAAAAAGCTGATGAGGG + Intergenic
1194487164 X:94498509-94498531 ATTCAATGGAAGACTGATCAAGG + Intergenic
1194502361 X:94697466-94697488 ATTCAGTGGAAGGCTTACCAAGG - Intergenic
1194663122 X:96647987-96648009 ATTCAGTTGAAGGATGAAGGAGG - Intergenic
1195617502 X:106924131-106924153 TTTCAGTGGAGGGCTAATGGTGG + Intronic
1198479806 X:137031057-137031079 AATCAGTGGAATGACGATGAAGG + Exonic
1199174945 X:144776458-144776480 AAGCAGTGGAAGGCTGATCAAGG - Intergenic
1199356919 X:146873535-146873557 ATTCAGTAGAAAGCTGATCAAGG + Intergenic
1199746831 X:150777026-150777048 ATTCAGTGAAAGGCTGATCAAGG - Intronic
1199752623 X:150835416-150835438 ATTACTTGGAAGGCTGAGGAAGG + Intronic
1200466602 Y:3527863-3527885 ATTCAGTGGAAGGCTGAACAAGG - Intergenic
1201276304 Y:12302117-12302139 ATTCAGTGGAAAGCTGATCAAGG - Intergenic
1201389481 Y:13481454-13481476 ATTCAGTAGGAGGCTGATCAAGG - Intergenic