ID: 1076977924

View in Genome Browser
Species Human (GRCh38)
Location 11:189542-189564
Sequence CTGTGGGTTTGGGGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1133
Summary {0: 2, 1: 0, 2: 6, 3: 104, 4: 1021}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076977911_1076977924 29 Left 1076977911 11:189490-189512 CCTGGGGGGCGGGGGGAGGCGCG 0: 2
1: 0
2: 13
3: 109
4: 886
Right 1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG 0: 2
1: 0
2: 6
3: 104
4: 1021
1076977910_1076977924 30 Left 1076977910 11:189489-189511 CCCTGGGGGGCGGGGGGAGGCGC 0: 2
1: 1
2: 3
3: 62
4: 563
Right 1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG 0: 2
1: 0
2: 6
3: 104
4: 1021

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076977924 Original CRISPR CTGTGGGTTTGGGGGGAGGT GGG Intronic
900679412 1:3908118-3908140 CTCTGGGTTTGTGGGGGTGTTGG + Intergenic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
900964038 1:5945203-5945225 CAGGGGCTGTGGGGGGAGGTGGG - Intronic
901096083 1:6681581-6681603 CTGGGGGTTTTGGGGAGGGTTGG - Intronic
901325897 1:8364902-8364924 CGGTGGGGTGGGGGGGAGGGGGG + Intronic
901675294 1:10879909-10879931 GTGTGTGTTGGGGGTGAGGTTGG + Intergenic
901703053 1:11055737-11055759 GTGGGGGTTGGGGGGAAGGTGGG - Intronic
901823880 1:11847968-11847990 CTGAGGGTCTGGGGGGCTGTTGG - Intronic
901876543 1:12169941-12169963 GTTTGGGTTAGGGGAGAGGTTGG + Intronic
901989426 1:13100716-13100738 CTGTGGGTTTTGCAGGATGTGGG + Intergenic
901992387 1:13126048-13126070 CTGTGGGTTTTGCAGGATGTGGG - Intergenic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
903071188 1:20727669-20727691 ATGTGTGTTTGGGGGGAATTTGG - Intronic
903171578 1:21557891-21557913 CTCTGGCTTTGGGAGGGGGTTGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903580308 1:24365811-24365833 CTGTGGGCCTGGGGGAAGGGAGG - Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903830380 1:26170804-26170826 CTCTGGGTTTGGGGAGCGGAGGG + Exonic
903838022 1:26218548-26218570 TTTTGGGGTTGGGGGGAGGGGGG + Intergenic
904064994 1:27742595-27742617 GGGTGGGTTTGGGGAGATGTTGG + Intronic
904299771 1:29546724-29546746 CTGTGGGTTTGGGAACAGATGGG + Intergenic
904770438 1:32878237-32878259 GTGTGTGTTTGGGAGGAGGAAGG + Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905020130 1:34804799-34804821 CTGTGGGGTTGGGTGGAGCAAGG - Intronic
905238527 1:36566730-36566752 CTGCGGGTTGGGGGTGGGGTGGG + Intergenic
905282964 1:36860670-36860692 CTCTGGGTCTGGGGGCAGGGTGG + Intronic
905287833 1:36895035-36895057 GTGTGTGTTGCGGGGGAGGTGGG + Intronic
905587633 1:39133212-39133234 CTGGGGGTATGGGGTGTGGTGGG + Intronic
905733774 1:40312819-40312841 CTGTGGGTCAGGGAGCAGGTTGG - Intronic
905928723 1:41771277-41771299 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906276645 1:44521566-44521588 CTGTGGGTGTGGGTGGGGGCAGG + Intronic
906671801 1:47661224-47661246 CTGTGGCTTTGGGTAGAGGGAGG + Intergenic
906677238 1:47701960-47701982 CTGGGGGTCAGGGAGGAGGTTGG - Intergenic
906783242 1:48591087-48591109 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
906872530 1:49499517-49499539 CTGGGGACTTGGGGGGAGGCTGG - Intronic
906917259 1:50024319-50024341 CTGTGTGTTTGGGTTGGGGTGGG - Intergenic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
906993023 1:50759295-50759317 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907272334 1:53298342-53298364 CTGAGGGGCTGGGAGGAGGTGGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907342531 1:53746680-53746702 CTGTAGGTTTTGGTGGTGGTGGG - Intergenic
908029887 1:59987838-59987860 CTGAGGTTTTTGGGGGAGTTGGG + Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908095962 1:60738873-60738895 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
908096400 1:60743313-60743335 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
908327983 1:63042550-63042572 CTCTCGGTCTGGGGGGATGTGGG + Intergenic
908703827 1:66930067-66930089 AGGTGGGTGTGGGAGGAGGTGGG - Intronic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910147105 1:84093305-84093327 CTGTGTGTGTGTGGTGAGGTAGG + Intronic
910201240 1:84701859-84701881 GTGTGTGTGTGGGGGGGGGTGGG + Intergenic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
910276221 1:85451755-85451777 TTGTGGGTCTGGGAGCAGGTGGG + Intronic
911728985 1:101272195-101272217 TTGTGGGGTAGGGGGGAGGGGGG - Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912145948 1:106794619-106794641 CTGGGGCAGTGGGGGGAGGTGGG + Intergenic
912409168 1:109467562-109467584 TGGTGGGTTTGGGGGCAGGACGG - Intronic
912435884 1:109660695-109660717 CTGAGGGATTTGGGGGAGGATGG + Intronic
912843352 1:113058789-113058811 CTGAGTGTTTGGGGAGAGGCCGG - Intergenic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
914069936 1:144277359-144277381 CTCTGGGGGTGGGGGGGGGTGGG - Intergenic
914109219 1:144688995-144689017 CTCTGGGGGTGGGGGGGGGTGGG + Intergenic
914337776 1:146731381-146731403 TTGTGGGGTCGGGGGGAGGGGGG - Intergenic
914401182 1:147321940-147321962 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
915118388 1:153614091-153614113 CTATGGGTTTGGGTTGAGGGTGG - Intergenic
915284808 1:154845931-154845953 CTATGGGCTTGGGGGCTGGTAGG - Intronic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
916697405 1:167253377-167253399 CTGTGTGTTTGGGGGGGGGGGGG - Intronic
916882225 1:169030365-169030387 CTGTGGAATTGGGGAGATGTTGG + Intergenic
917232422 1:172852535-172852557 CTGTCGGTGGGGTGGGAGGTTGG - Intergenic
917359934 1:174164101-174164123 CAATGGGTTGGGGGGCAGGTAGG - Intronic
917362033 1:174187212-174187234 TAGTGGGCTTGTGGGGAGGTTGG - Intronic
917438005 1:175040463-175040485 CTGGGGGCTAGGGGGAAGGTTGG + Intergenic
917470865 1:175324784-175324806 CTGAGGGTTGGGGGTGGGGTGGG - Intronic
917906069 1:179588155-179588177 CTGTTGGTGTGAGGGGAGGTGGG - Intergenic
917931259 1:179824373-179824395 CTGTTGGTGTGGGGAGAGGGGGG - Intergenic
918168983 1:181977037-181977059 CTGTGGGGTCGGGGGGAGGCAGG + Intergenic
918212436 1:182362999-182363021 CTGGGGGTGTGTTGGGAGGTGGG - Intergenic
918913588 1:190605864-190605886 TTGTGTGTGTGGGGGGGGGTGGG + Intergenic
919019952 1:192092708-192092730 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
919020444 1:192098456-192098478 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
920044384 1:203124161-203124183 CTGTGTGTTTGTGAGGCGGTGGG - Intronic
920596190 1:207272867-207272889 CTAGGGGTTGAGGGGGAGGTGGG - Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
920997850 1:211012311-211012333 CTGTGGGTTTGATTGGAGGGTGG - Intronic
921049982 1:211504366-211504388 CTGGGGGTTTGGTGGGTGGTGGG - Intergenic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
921285408 1:213604835-213604857 CTGTGGGTCTGGGGAAGGGTGGG + Intergenic
921790574 1:219285702-219285724 CTTAGGGTCTGAGGGGAGGTAGG + Intergenic
921811455 1:219519064-219519086 CTATGGGCTGGGGGTGAGGTTGG - Intergenic
921850867 1:219930476-219930498 TTCTGTGGTTGGGGGGAGGTGGG - Intronic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
922129462 1:222762570-222762592 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
922178064 1:223212531-223212553 CTGATGGCTTGGTGGGAGGTGGG + Intergenic
922181348 1:223235521-223235543 TTGGGGGTTTGGGGGTGGGTGGG - Intronic
922696136 1:227731973-227731995 CTGTGGGTTCAGGGAGGGGTTGG - Exonic
922934919 1:229415202-229415224 CTTTGGGTTTGGGAGAAGGCTGG - Intergenic
923018055 1:230142153-230142175 CTGTGGAGGTGGGGGGAGGGTGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923630462 1:235646354-235646376 CAGCGGGTTTGGTGGGTGGTGGG - Intronic
923660535 1:235953197-235953219 CTGTGGTTTTGGGGTAAGGTGGG - Intergenic
923933447 1:238730630-238730652 CTGGGGGTTTGGGGGAAGTCTGG + Intergenic
924085495 1:240447251-240447273 CTGTGTGTGTTGGGGGATGTTGG + Intronic
924242907 1:242057319-242057341 CTGGGGGTGGGGGTGGAGGTGGG + Intergenic
924359036 1:243216348-243216370 TTGTGGGGTCGGGGGGAGGGGGG - Intronic
924619664 1:245649679-245649701 CTGTGTTTTTTGGGGGGGGTGGG - Intronic
924710916 1:246529436-246529458 GTGGGGGTTTGGGGGCAGTTGGG - Intergenic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1063021550 10:2133990-2134012 CTGTGCGTGTGGGGGGATGGAGG + Intergenic
1063278552 10:4598611-4598633 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1063470803 10:6283316-6283338 GTGTGCGTATGGGGGCAGGTGGG + Intergenic
1063651802 10:7945590-7945612 CTGTAGGGGTGGGAGGAGGTAGG - Intronic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1066486633 10:35852076-35852098 CAGTGGGTTTGGGGGCAGAGGGG + Intergenic
1067156504 10:43785446-43785468 CTGTGGGTTGTGGGAGAGCTTGG + Intergenic
1067177864 10:43962729-43962751 CTGTGACTTTGCGGGAAGGTAGG - Intergenic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068451529 10:57196124-57196146 TTGTGGGGTTGGGGGGAGCGGGG - Intergenic
1068571650 10:58636439-58636461 TTGTGTGTTGGGGAGGAGGTGGG - Intronic
1068577179 10:58697790-58697812 CAGGGGGTGTGGGTGGAGGTTGG - Intronic
1068899351 10:62249373-62249395 TTGCGGGGTTGGGGGGTGGTGGG + Intronic
1069152159 10:64976582-64976604 TTGGGGGTTTGGGGGTAGCTGGG + Intergenic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069281113 10:66654935-66654957 CTGTGGGATGGGGTGGAGTTGGG + Intronic
1069370769 10:67745506-67745528 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1069754407 10:70764343-70764365 CTGAAGGCTTGGGGGAAGGTAGG + Intergenic
1069921895 10:71820543-71820565 TGGTGGGGTTAGGGGGAGGTGGG - Intronic
1071294119 10:84206871-84206893 CTGTGGGGCTGAGGGTAGGTGGG + Intronic
1071374662 10:84990447-84990469 GTGTGTGTTGGGGGGGAGGAGGG + Intergenic
1071526531 10:86362865-86362887 CAGTGGGTGTAGTGGGAGGTGGG - Intronic
1072174328 10:92901890-92901912 CTGGGGGGTTGGTGGGGGGTGGG + Intronic
1072341818 10:94459587-94459609 CAGGGGGGTTGGGGGGAGCTCGG + Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072631463 10:97149720-97149742 ATGTGGGTTTGGGGTCAGGTGGG + Intronic
1072844629 10:98816024-98816046 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1072881843 10:99235913-99235935 GTGTGTGTTGGGGGGGTGGTGGG - Intergenic
1072924020 10:99600344-99600366 CCCTGGGTATGGTGGGAGGTAGG - Intergenic
1073073129 10:100807383-100807405 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1073073164 10:100807536-100807558 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1073585851 10:104709159-104709181 CTGTGTGTTTGGGAGGAGGCGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1075022025 10:118959158-118959180 CTATGTGTATGGGGGGTGGTGGG - Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075480910 10:122780867-122780889 CTGGAGGTGTGGGTGGAGGTAGG - Intergenic
1075645623 10:124094106-124094128 CTTTGGGTTGGGGGGGCGGACGG - Intergenic
1075737527 10:124673199-124673221 CTGTAGGTTCTGGGGGAGGTGGG - Intronic
1075945352 10:126428258-126428280 CTGTGGGTGTCTGGGGAGCTGGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076709479 10:132324056-132324078 GTGTGGGTGTGTTGGGAGGTGGG - Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077144822 11:1040148-1040170 CTGTGGGTTTGGGGAGTGTTTGG + Intergenic
1077428774 11:2503536-2503558 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
1077687346 11:4307750-4307772 TTGGGGGTTGGGGAGGAGGTGGG + Intergenic
1077692514 11:4358937-4358959 TTGGGGGTTGGGGAGGAGGTGGG + Intergenic
1077696813 11:4400964-4400986 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1077703530 11:4462840-4462862 TTGTGGGTTTGGTGAGAGGGTGG - Intergenic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1077865030 11:6214910-6214932 GCCTGGGTTGGGGGGGAGGTGGG + Exonic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078654149 11:13222511-13222533 CTGTGAGTCAGAGGGGAGGTTGG - Intergenic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079947021 11:26756839-26756861 CTGTGGGGTTGAGGAGAGGTTGG - Intergenic
1080305999 11:30837043-30837065 ATGTGTGTTTGAGGGGAGGATGG + Intronic
1080380645 11:31768856-31768878 CTGGGGGTGTGGGGGTAGGGAGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080479966 11:32637585-32637607 GTGTGTGTTTGGGGGCAGGAGGG - Intronic
1080565635 11:33506893-33506915 CCCTGGTTTTGGTGGGAGGTGGG - Intergenic
1081143304 11:39531437-39531459 TTGGGGGTTTAGTGGGAGGTGGG - Intergenic
1081428008 11:42946174-42946196 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1081498711 11:43644291-43644313 CGGAGGGTTTGGGGGGCTGTCGG + Intronic
1081549868 11:44101099-44101121 CAGTGGGTTGGGGGTGGGGTGGG + Intronic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083594172 11:63911145-63911167 CTGTGGGTAAGTGGGGAGCTGGG - Intergenic
1083744415 11:64727238-64727260 CTGAGGGCTGGGGGGGAGCTGGG - Intronic
1083830115 11:65226027-65226049 CAGTGTGTCTGGGGTGAGGTGGG + Intergenic
1083903387 11:65654746-65654768 GGGTGGGCTTGGGGGCAGGTGGG + Exonic
1083994099 11:66263752-66263774 GTGAGGGTTGGGTGGGAGGTGGG + Intronic
1084403069 11:68956111-68956133 CTGGGGGTTGGGGGGCAGGGTGG + Intergenic
1084496660 11:69509129-69509151 CTGATGGTTTGGGGGCAGGAAGG + Intergenic
1084661538 11:70549342-70549364 CTGTGGGCTTGGGGTGAGAGAGG - Intronic
1085177871 11:74506741-74506763 ATGTGGGATGGTGGGGAGGTGGG - Intronic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085511718 11:77091594-77091616 CTGTGGGTATGGTGGAGGGTGGG - Intronic
1085961079 11:81462882-81462904 AGGTGGGTTTGGGGGGAGAGGGG - Intergenic
1086340048 11:85839448-85839470 ATGGGGGATTGAGGGGAGGTGGG + Intergenic
1086352913 11:85961074-85961096 ATGTGTGTATGGGGGGTGGTGGG + Intronic
1086842810 11:91708452-91708474 GTGTGGGTTTGTGAAGAGGTAGG - Intergenic
1086905973 11:92418425-92418447 CTGTGTGTGTGTGGGGGGGTGGG - Intronic
1086928224 11:92664013-92664035 GTGTGTGTTTGGGGGAGGGTGGG - Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087435316 11:98109859-98109881 TTGTGTGTGTGGGGTGAGGTAGG + Intergenic
1087513027 11:99122128-99122150 AAGTGGAGTTGGGGGGAGGTTGG - Intronic
1087888681 11:103511447-103511469 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
1088253166 11:107879205-107879227 CGGGGGGGTTGGGGGGCGGTGGG - Intronic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1089124057 11:116163580-116163602 CTCTAGACTTGGGGGGAGGTGGG + Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089369684 11:117946632-117946654 CTGTGGGTTTGGGCTGAGCCAGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089563382 11:119357104-119357126 GGGTGGGTTTGGGGGGAGGGTGG + Intronic
1089911531 11:122105565-122105587 CTGTGGGTTTGAAAGGAGCTGGG - Intergenic
1090351228 11:126109916-126109938 ATGTGGGTTTGGCCTGAGGTGGG - Intergenic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1091881157 12:3979299-3979321 CTGTGAGTTTGGGGGTGGGGAGG + Intergenic
1092013118 12:5132766-5132788 CTTTGCGTTTGGGGACAGGTTGG - Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1092903018 12:13077415-13077437 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1092971517 12:13700097-13700119 CTGTCTGTCTGTGGGGAGGTGGG + Intronic
1093109555 12:15132981-15133003 CTGTGTGTTGGGGGGCAGGGCGG - Intronic
1093224340 12:16463432-16463454 CTCTGGGGGTGGGGGGAGGGAGG + Intronic
1093236014 12:16609293-16609315 CTTTGGGGTTGGGGGGAGCCAGG - Intronic
1093246629 12:16746095-16746117 TTGGGGGTTGGGGAGGAGGTAGG + Intergenic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1094661064 12:32471125-32471147 GTGGGGGTTGGGGGGAAGGTTGG - Intronic
1094785086 12:33838821-33838843 TTGTGGGGTTGGGGGGAGCGGGG + Intergenic
1094825173 12:34264188-34264210 CTCTGGGTTGGGGTGGAGTTTGG - Intergenic
1095101241 12:38186157-38186179 TTGTGGGCTGGGGGGGAGGGGGG + Intergenic
1095137463 12:38622927-38622949 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1095800604 12:46267724-46267746 CCGGGGGTTGGGGAGGAGGTGGG + Intronic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096084577 12:48857225-48857247 CTTTGGAATTGGGGGGAGGGGGG - Exonic
1096097203 12:48943563-48943585 ATGGGGGTTTGGTGGGAGTTTGG + Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096695474 12:53345610-53345632 GTGTGGCTTGGTGGGGAGGTAGG - Intergenic
1096725145 12:53555341-53555363 GTGAGGGTTTGGGGGAAGGAGGG + Intronic
1096791533 12:54047954-54047976 CTTTGGGTTTGAGGGGATGGAGG + Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097534863 12:60855924-60855946 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1097751181 12:63354577-63354599 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1098186922 12:67906545-67906567 CTGGGGGTTTGGGGAGATGTTGG - Intergenic
1098957944 12:76706841-76706863 CTGTAGTTTTGGGGAGAGGAAGG + Intergenic
1099124213 12:78732137-78732159 CTGACAGTTTGGGAGGAGGTGGG + Intergenic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1100449460 12:94691528-94691550 GTGAGGGTTGGCGGGGAGGTTGG - Intergenic
1100910854 12:99360967-99360989 CTGGGGGACTGCGGGGAGGTGGG + Intronic
1100951245 12:99852904-99852926 CTGTGAGTTGCGGGGGAGCTGGG + Intronic
1101302623 12:103496771-103496793 ATGTGGGTGTGTGGGGTGGTGGG - Intergenic
1101583462 12:106064790-106064812 TTGTGTGTGTGGGGGGGGGTGGG - Exonic
1101717314 12:107321761-107321783 CTGTGCTTTTTGGTGGAGGTAGG - Intronic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1102645649 12:114401980-114402002 CTCTGTGTTTTGGGGGAGTTTGG - Intronic
1102983986 12:117264130-117264152 ATGCGGGGTTGGGGGGAGGGGGG + Intronic
1103331839 12:120159733-120159755 CTGAGTGCTTGTGGGGAGGTGGG - Intronic
1103331976 12:120160401-120160423 CTGTGGACTTTGTGGGAGGTTGG - Intronic
1103900576 12:124301719-124301741 CTGAGTGTCTGGGGGGAAGTGGG + Intronic
1103904375 12:124320032-124320054 CTCTTTCTTTGGGGGGAGGTGGG + Intergenic
1103939194 12:124492772-124492794 CTGTGGGTTGGAGGTGAGCTGGG - Intronic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104660967 12:130611257-130611279 CTGTGGGGTCTGGGGGACGTGGG - Intronic
1104696838 12:130870746-130870768 CTGAGGGTTCTGGGGGAGCTCGG + Intergenic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1105458210 13:20560428-20560450 CAGTGGGCTTGAGGGGAGATTGG - Intergenic
1105688210 13:22807421-22807443 GTTGGGGTTTGGGGAGAGGTTGG + Intergenic
1105818306 13:24057226-24057248 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1105844191 13:24280809-24280831 GTGTGAGTTTGGGGGTGGGTTGG - Intronic
1106304406 13:28496553-28496575 CTGTGGGTTTTAGAGGAGGCAGG - Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1106880562 13:34124858-34124880 GTTTGGGGTTGGTGGGAGGTAGG + Intergenic
1107044000 13:35976170-35976192 GGGTGGGTTTGGAGGCAGGTTGG + Intronic
1107613552 13:42141046-42141068 TTGTGGGGTTGGTGGGAGGGGGG - Intronic
1108499789 13:51059637-51059659 ACGTGGGTTGGGGGAGAGGTGGG - Intergenic
1109336136 13:60997158-60997180 GAGTGGGTTAGGGGAGAGGTGGG - Intergenic
1109833618 13:67826371-67826393 CCGTGGGGTGGGGGGGAGGGGGG + Intergenic
1110192126 13:72742242-72742264 TTCTGGTTTTGGGGGGAGGGGGG + Intronic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110789746 13:79574673-79574695 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1111812429 13:93107734-93107756 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1111962462 13:94826188-94826210 CTGGGGGTTTGGGGGGTGGGGGG - Intergenic
1111968237 13:94882798-94882820 GTGTGTGTTTGGGGGGTGGGGGG - Intergenic
1112060477 13:95734964-95734986 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112075077 13:95904439-95904461 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112104091 13:96221515-96221537 CAGTGGGATGGGGAGGAGGTAGG + Intronic
1112616461 13:101011804-101011826 CTCAGGGTTTGGGGGGATTTCGG - Intergenic
1112699450 13:101988703-101988725 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1112792917 13:103023173-103023195 ATGGGGGTTTGGGGAGAGGTTGG - Intergenic
1112983794 13:105421059-105421081 CTGTGTGTGTTGGTGGAGGTGGG + Intergenic
1113454545 13:110438799-110438821 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
1113583482 13:111446636-111446658 CTGGGTTTTTGGGGGGAGGTAGG - Intergenic
1113901353 13:113800086-113800108 GTGTGTGTGTGGGGGGGGGTAGG + Intronic
1113901376 13:113800185-113800207 GTGTGTGTGTGGGGGGGGGTAGG + Intronic
1113911962 13:113846470-113846492 CTGTGGGTTTGGGCGGCTTTAGG - Intronic
1114051139 14:18920533-18920555 CTGGCGGTTGGGGGGGGGGTTGG + Intergenic
1114083243 14:19219476-19219498 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1114234502 14:20812657-20812679 CTGTGGGGTGGGGGTGGGGTGGG - Intergenic
1114657213 14:24323282-24323304 CTGTGGGCTTGGGCTGAGGAAGG + Intronic
1114683123 14:24503728-24503750 TTGTGGGGTTGGGGGGGGGTAGG + Intronic
1115212740 14:30984134-30984156 CTTTGTGTGTGGGGGGGGGTTGG - Intronic
1115389648 14:32840742-32840764 GTGTGTGTGTGGGGGGGGGTGGG - Intergenic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1115955083 14:38768682-38768704 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1116436129 14:44897251-44897273 CGGGGGGGTTGGGGGGAGGGGGG + Intergenic
1117132040 14:52695924-52695946 CTGCGGGGTTGGGGGGCGGGGGG + Intergenic
1117423632 14:55573265-55573287 CTGGGGGGTTGGGGTGTGGTTGG - Intronic
1118249170 14:64142348-64142370 CTGTGGTTATTGGGGGTGGTGGG - Intronic
1118279586 14:64416422-64416444 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
1118355787 14:65012507-65012529 CTGTGGCTCTGGCAGGAGGTAGG + Intronic
1118442777 14:65827309-65827331 TTGGGGCTTTGGGGGGTGGTGGG - Intergenic
1118887086 14:69876586-69876608 CTCTGGGCTTGGGAGGAGTTGGG + Intronic
1118961565 14:70538143-70538165 CTGAGGGCTTGGGGGCAGGGCGG - Intergenic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119477659 14:74940398-74940420 CTGGGGCTTTGAGGGGAGCTGGG - Intergenic
1119757335 14:77128385-77128407 CTGTGGGTGGGAGTGGAGGTAGG - Intronic
1119974597 14:79011385-79011407 GGGTGGGGTTGGGGGGAGGTGGG - Intronic
1120694695 14:87631582-87631604 CTGTGAATTTGGGTGGAGGCTGG - Intergenic
1120736355 14:88057475-88057497 CTGTGGCTGTGGTGGGGGGTGGG + Intergenic
1121123843 14:91393328-91393350 CTGGGGGTTTAGGGGGTGGGGGG - Intronic
1121225722 14:92320495-92320517 CTGTGGGGTTGGGGAGGGGGCGG + Intergenic
1121392654 14:93589431-93589453 CTGGGGGATGGGGGGGAAGTTGG + Intronic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1122416070 14:101550094-101550116 CTGAGGGTCCGGGAGGAGGTGGG - Intergenic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122769813 14:104092958-104092980 CTGGGGGTGTGGGAGGAGGGTGG - Intronic
1122906821 14:104805451-104805473 CGGTGGGTGTGGGAGGGGGTAGG - Intergenic
1122974693 14:105166275-105166297 CAGTGGGTGTGGGGGCAGGGAGG - Intronic
1202894865 14_GL000194v1_random:1246-1268 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1202861925 14_GL000225v1_random:88880-88902 CTGAGGGTTGGGGGTGGGGTGGG + Intergenic
1123887757 15:24744345-24744367 TTGTGAGGTTGGGGGGAGGGGGG - Intergenic
1124011558 15:25843269-25843291 ATGTGGGTTTGGGTGGTGATAGG - Intronic
1124034328 15:26040156-26040178 GTGAGGGTTGGTGGGGAGGTAGG - Intergenic
1124594469 15:31081647-31081669 CTGTGGCTTTGGTGCGAGGTTGG - Intronic
1125430105 15:39585089-39585111 TTATGTGTTTGGGGGGAGGAAGG - Intronic
1125512638 15:40301077-40301099 ATGTGGCGTTGGGGAGAGGTAGG - Intronic
1126070049 15:44858298-44858320 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1126190229 15:45871307-45871329 CTGTGGGCTACGTGGGAGGTAGG + Intergenic
1126679805 15:51191923-51191945 CCGGTGGTTGGGGGGGAGGTGGG + Intergenic
1127304140 15:57685502-57685524 CTGTGTGTGTCGGGGGAGGGTGG + Intronic
1127320076 15:57835616-57835638 CTGTGGGGTGGGGGGGTGTTGGG + Intergenic
1127779009 15:62295130-62295152 CTTTTGCTTTGGGTGGAGGTAGG + Intergenic
1127780771 15:62313149-62313171 TTGGGGGTTGTGGGGGAGGTGGG + Intergenic
1127911415 15:63419198-63419220 TTGTTGGTTGGAGGGGAGGTAGG - Intergenic
1128350208 15:66883441-66883463 ATGTGGGTTGTGGGGGAGATGGG - Intergenic
1128888847 15:71312745-71312767 CTGTGGGGTGGTGGGGAAGTGGG - Intronic
1129053079 15:72798363-72798385 GTGTGTGTTTGGCGGGGGGTGGG + Intergenic
1129318452 15:74760519-74760541 GTGTGGGTGTGAGGAGAGGTGGG - Intergenic
1129660484 15:77550322-77550344 GTGTGGCTTTGGGGAGGGGTGGG + Intergenic
1129700049 15:77762656-77762678 CTGAGAGTTTGGGTGGAGGGTGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129897039 15:79116151-79116173 CAGTGCGTATGGGGGGAGGGGGG - Intergenic
1130264694 15:82389811-82389833 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131107831 15:89746780-89746802 GTGTGTGTGTGTGGGGAGGTAGG - Intergenic
1131158747 15:90090840-90090862 CTGGGGCTTTGGAGAGAGGTTGG + Intronic
1131829280 15:96344014-96344036 CTCTGGGTTGGGGGTGAGGTGGG + Intergenic
1131994715 15:98122985-98123007 TTGTTTGTTTGTGGGGAGGTGGG - Intergenic
1132013964 15:98299931-98299953 CTGTGGGATGGGCTGGAGGTGGG - Intergenic
1132260773 15:100422932-100422954 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1132341821 15:101083726-101083748 CTGTGGGGTGCAGGGGAGGTAGG - Intergenic
1132655718 16:1040986-1041008 CTGGGGGTCTGGGAGGAGATGGG - Intergenic
1132655727 16:1041011-1041033 CTGGGGGTCTGGGAGGAGGTGGG - Intergenic
1132655779 16:1041169-1041191 CTGGGGGTCTGGGAGCAGGTGGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132789640 16:1678438-1678460 GTGTGGGGTTGGGGTGGGGTTGG + Intronic
1132819913 16:1859836-1859858 CTGCGGGTTTGGGGAGTGGATGG + Intronic
1132887738 16:2189871-2189893 CTGTGGGTTTGGGGGGTGCTAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132998565 16:2837383-2837405 GTCTGGGTGTGTGGGGAGGTGGG - Intronic
1133033711 16:3023453-3023475 CAGTGAGTTTGGGGGCAGGGAGG - Exonic
1133232742 16:4374177-4374199 CTGTGTATTTGGGGGTGGGTGGG + Intronic
1133317530 16:4893674-4893696 CTGTGGGTGCAGGGGGTGGTGGG - Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1133697445 16:8278289-8278311 CTATGATTTTGGGGTGAGGTGGG + Intergenic
1133726525 16:8542611-8542633 CTGTGGGTTTGGGGTGGGGGAGG + Intergenic
1133868466 16:9666059-9666081 ATGTGGATTTAGGGGGAGGGCGG - Intergenic
1133966017 16:10532186-10532208 CTGTAGGTCTGGGGTGAGGGGGG + Exonic
1134048969 16:11123688-11123710 CGTTGGGTTTGGGAGGAGGGTGG - Intronic
1134122919 16:11597339-11597361 CTGGGGGTGTGGGGAGAGGCTGG + Intronic
1134534243 16:15012745-15012767 CAGAGGCTTTGGTGGGAGGTTGG + Intronic
1135235901 16:20755777-20755799 CTGTGGGGTGGGGGGGGGGGAGG - Intronic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136269820 16:29141820-29141842 CTGTGGCATGGGGGGGTGGTGGG + Intergenic
1136272963 16:29159238-29159260 CAGTGGGGTGGGGGGGTGGTGGG + Intergenic
1136496240 16:30646577-30646599 TGGTGGGGTGGGGGGGAGGTGGG + Intergenic
1136552847 16:30990743-30990765 TTGTGGGTTTGGTGGCAGGTAGG - Exonic
1137334516 16:47534112-47534134 CTGTGGGGTTGGCGGGAGCCAGG - Intronic
1137527902 16:49252614-49252636 CAGAGGATTTGGGGTGAGGTAGG + Intergenic
1137672424 16:50286845-50286867 CTCTGGGTATGGTGTGAGGTAGG - Intronic
1138173110 16:54871515-54871537 ATGTGGATTTAGTGGGAGGTGGG - Intergenic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1139261598 16:65599569-65599591 CTGTGTGTTGGGGGTGAGATGGG + Intergenic
1139472212 16:67184347-67184369 CTGTGTGTGTTGGGGAAGGTGGG - Exonic
1139861799 16:70027984-70028006 CAGAGGCTTTGGTGGGAGGTTGG - Intergenic
1139996504 16:70985952-70985974 TTGTGGGGTCGGGGGGAGGGGGG + Intronic
1140213295 16:72987623-72987645 CTGTGTGTTTGGGAGTAGGTGGG - Intronic
1140219559 16:73033706-73033728 ATTTGGGTTTGGAGGGAGGGAGG - Intronic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1140509321 16:75495651-75495673 CTGGGGATTTGGGGTGGGGTGGG - Intergenic
1140548526 16:75836586-75836608 CTGTGGGGTGGGGGGAGGGTAGG + Intergenic
1140716465 16:77730273-77730295 GAGGTGGTTTGGGGGGAGGTTGG - Intronic
1140857810 16:78993258-78993280 ATTTGGGGGTGGGGGGAGGTTGG + Intronic
1140869446 16:79093216-79093238 CGGTGTGGTTGGGAGGAGGTGGG + Intronic
1141163938 16:81647906-81647928 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163950 16:81647938-81647960 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141163974 16:81648002-81648024 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141190195 16:81819133-81819155 CTGTGGGGTTCAGTGGAGGTTGG + Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141493929 16:84393735-84393757 CTATGGGTGTGGGGGGAGTGGGG + Intronic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142172605 16:88630753-88630775 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
1142185360 16:88692300-88692322 CTGTGGGTTTGTGGGGACTGGGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142631087 17:1227296-1227318 ATGTGGGTCTGGGGGGAGACAGG + Intronic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143060448 17:4196090-4196112 GTGTGTTTTTGGGGGGAGGTGGG - Intronic
1143594770 17:7907584-7907606 CTGTGGCTGTGGGAGGGGGTAGG - Exonic
1143718859 17:8796454-8796476 ATGTGTGTTGGGGGGGAAGTGGG - Intergenic
1143864098 17:9911481-9911503 CTCTGGGGGTGGGGTGAGGTTGG - Intronic
1144713211 17:17416521-17416543 CTGTGGCTCTGTGGGGAGATGGG + Intergenic
1144830357 17:18127571-18127593 GTGTGGGTTAGGGGTGGGGTGGG + Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145880676 17:28350700-28350722 CTGGGGGTCAGGGTGGAGGTGGG - Intronic
1145957386 17:28863974-28863996 CTGAGGGAATGGGGTGAGGTGGG - Intergenic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146675662 17:34772257-34772279 CTGTGGGTCTGTGGGCAGCTGGG - Intergenic
1146905968 17:36618070-36618092 CTGGGGCTTTAGGGGGAAGTGGG + Intergenic
1146937869 17:36823877-36823899 CTGTGGGTACAGGGGAAGGTGGG + Intergenic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147256301 17:39184390-39184412 GTGGGGGTTTGTGGGGAGGGAGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147987328 17:44314220-44314242 CTGTGGGTTCACAGGGAGGTTGG + Intronic
1148048854 17:44759492-44759514 CTGCGGGTTTGGGCGGATGGGGG + Intronic
1148158996 17:45439421-45439443 CTGTGGGTGTGGGGAAGGGTGGG + Intronic
1148177975 17:45584463-45584485 CGGCGGGGTTGGGGGGAGATCGG + Intergenic
1148464609 17:47857492-47857514 CTTGGGGTTGGGGGGGAGTTTGG + Intergenic
1148471064 17:47893721-47893743 CAGGGGTTTTGGGGGGAGGTAGG - Intergenic
1148809255 17:50279821-50279843 CTCTGGCTGTGTGGGGAGGTGGG + Exonic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1149442473 17:56686206-56686228 ATGTGGGTTTAGGGGCAGGGGGG + Intergenic
1149557935 17:57587553-57587575 CTTTGGGGCTGGGGGGAGTTGGG - Intronic
1149673683 17:58439014-58439036 TTGGGGGGTTGGGGGTAGGTTGG + Intronic
1149891233 17:60392050-60392072 TTGTTAGTGTGGGGGGAGGTGGG - Exonic
1149949253 17:60967738-60967760 TTGGGGGTGTGGGGGGTGGTGGG - Intronic
1150574201 17:66415716-66415738 CTGTTGGTTTCTGGGTAGGTTGG + Intronic
1150575272 17:66425267-66425289 CTGTGGATGTTGGTGGAGGTGGG - Intronic
1150630484 17:66877093-66877115 CTGCGGGGTTAGGGGGAGGGTGG + Intronic
1150839788 17:68597097-68597119 GTGTGGGTGAGTGGGGAGGTGGG + Intronic
1151029551 17:70720837-70720859 GTGTGGTGTTGGGGGAAGGTGGG - Intergenic
1151538558 17:74752352-74752374 GTGTGGTTTTGGGGGTAGGGAGG - Intronic
1151555682 17:74845621-74845643 CTCTGGGTTTGGGGGCAGGCTGG + Intronic
1151805987 17:76405729-76405751 CTGTGGGTCTGGGTGCTGGTCGG - Intronic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152636568 17:81432781-81432803 CTGGGGATGTGGGGGGAGGGTGG - Intronic
1152636621 17:81432879-81432901 CTGGGGATGGGGGGGGAGGTTGG - Intronic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1152754556 17:82081844-82081866 CTGTGGGGGAGGGGGCAGGTGGG + Intronic
1153200508 18:2642952-2642974 CTGTGGCTTTGCTGGGAGTTTGG + Intergenic
1153245914 18:3072690-3072712 GTGTGTGTGTGGGGGGCGGTGGG + Intronic
1153408459 18:4766763-4766785 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1153696379 18:7646902-7646924 CTGTATTTTTAGGGGGAGGTGGG + Intronic
1153778679 18:8475949-8475971 CTGTTGGTTGGGGAGCAGGTGGG + Intergenic
1153873740 18:9346147-9346169 CTAGGGGACTGGGGGGAGGTAGG - Intronic
1153995139 18:10434150-10434172 CTGTGGGTTGGGGGGGGTGGTGG - Intergenic
1154425152 18:14266199-14266221 CAGTGGGTTGTGGGGGTGGTAGG + Intergenic
1155077039 18:22367795-22367817 CTGTGTGTGTGGCGGGAGCTGGG + Intergenic
1155344013 18:24840953-24840975 GTGTGTGTTTGGGATGAGGTGGG + Intergenic
1155485303 18:26335259-26335281 CTTTGTGTTTGAGGGAAGGTTGG + Intronic
1156474480 18:37397105-37397127 ATGAGGGTTTGTGGGGAGCTGGG - Intronic
1157019157 18:43758218-43758240 CTGTGTGTTGGGGTGCAGGTGGG + Intergenic
1157120139 18:44901541-44901563 CTTTGGGTATGATGGGAGGTAGG + Intronic
1157276107 18:46312037-46312059 GTGTGGGGTTGGGGGGTGCTCGG + Intergenic
1157650881 18:49329281-49329303 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1157916475 18:51668526-51668548 CTGTCGGGTGGGGGGGCGGTGGG + Intergenic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158573307 18:58614904-58614926 GTGTGTGTTGGGGGGGAGGGTGG - Intronic
1158602250 18:58864576-58864598 CTGTGGGGTGGAGGGGAGGGGGG + Intronic
1159313526 18:66740107-66740129 TCGTGGGGTCGGGGGGAGGTGGG + Intergenic
1159543492 18:69811310-69811332 CTGATGGATTGGGGAGAGGTTGG + Intronic
1159690092 18:71476793-71476815 TTGTGGGATAGGGGGGAGGGGGG + Intergenic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1160543114 18:79636139-79636161 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160979816 19:1811783-1811805 CTGTGGGACGGGGGAGAGGTGGG + Exonic
1161218235 19:3105383-3105405 CTGTGGATTTGGGGGGTTGGGGG + Intronic
1162107528 19:8379072-8379094 CTCTGGGTTTGATGGGAGGGAGG + Intronic
1162183472 19:8886625-8886647 CTCTGGGTGTGAGAGGAGGTGGG + Intronic
1162588501 19:11576211-11576233 CTGTGGGTGGGGTGGGAGCTGGG - Intronic
1162923653 19:13918833-13918855 CTCTGGGGTTGGGGGCAGGCTGG + Intronic
1162923712 19:13919048-13919070 CTGGGGGTTCCGGGGGAGGTGGG + Intronic
1163035448 19:14566626-14566648 CTGTGGGTGTTGGCGGGGGTGGG + Intronic
1163229424 19:15990135-15990157 TGGTGGGGTTGGGGGGAGGATGG + Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163639178 19:18451752-18451774 CTCTGGATTTGGGAGGAGGGGGG - Intronic
1163959150 19:20671072-20671094 GTGTGTGTTTGGGAGTAGGTGGG - Intronic
1164776718 19:30858641-30858663 CTGTGGGATCAGGGGAAGGTGGG - Intergenic
1164852294 19:31494187-31494209 CTGTGGAGTTGGGTGGAGGATGG - Intergenic
1164902364 19:31938921-31938943 CTGTGGGATTGGGGGGTTGGGGG + Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165311622 19:35032019-35032041 GTGGGGGATTGTGGGGAGGTGGG - Intronic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1165901751 19:39172594-39172616 CTGAGGGGTTTGGGGGAGGAAGG - Intronic
1165938526 19:39403515-39403537 CTGTGGGTTTGGGGAGGTGGAGG + Intergenic
1166283584 19:41810448-41810470 CTGTGTGTTTTGGGGGAAGGTGG - Intronic
1166954123 19:46451087-46451109 CTATGGCTTTTGTGGGAGGTTGG + Intergenic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167513594 19:49909954-49909976 CAGTCGGTTTGGAGGGTGGTGGG + Intronic
1167524241 19:49973621-49973643 CGGAGGGTTTGGGGAGATGTTGG - Intergenic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167687834 19:50967849-50967871 ATGAGGGTTTGGGGTGGGGTTGG - Intronic
1167695942 19:51015721-51015743 CTGTGAGTCTGAGGGGAGGAGGG - Intronic
1167851586 19:52206319-52206341 CTGTGGGTTTAGAGTCAGGTTGG + Intronic
1168058190 19:53875224-53875246 GTGTGTGTTTGGGGGGTGGGGGG + Exonic
925554111 2:5110535-5110557 CTTGGAGGTTGGGGGGAGGTGGG - Intergenic
926011011 2:9407882-9407904 CTGTGTGTTTGGGGGTGGGGGGG + Intronic
926132256 2:10311157-10311179 CTGAGGGATTGGGGGGCGGGGGG - Intronic
926359349 2:12070975-12070997 CTGTGGGTTATGGGGAAGGCTGG + Intergenic
926730908 2:16034662-16034684 TGGAGGGTTTGGGGGGAAGTGGG + Intergenic
927570156 2:24152610-24152632 CTGTTTGTTTGGGAGAAGGTGGG - Intronic
927581155 2:24249352-24249374 CAGTCAGTTTGGGGGGAGGATGG - Intronic
928498592 2:31862924-31862946 AAATGGGATTGGGGGGAGGTGGG + Intergenic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929317162 2:40493342-40493364 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
929895317 2:45954966-45954988 ATGGGGGTATGGGGTGAGGTTGG + Intronic
929968589 2:46553907-46553929 TTGGGGGTTTGGCGGGAGGTAGG - Intronic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931694535 2:64861874-64861896 TGGTGGCTTTGGAGGGAGGTAGG - Intergenic
931846788 2:66212213-66212235 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
932140566 2:69273670-69273692 GTGTGGGTGGGGGAGGAGGTGGG - Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933593591 2:84260554-84260576 TTCTGGCTTTGGGGAGAGGTAGG - Intergenic
933617633 2:84499172-84499194 TGGGGGGTTTGTGGGGAGGTGGG - Intergenic
933775763 2:85770329-85770351 GAGTGGGGTTGAGGGGAGGTTGG + Intronic
933916743 2:87002348-87002370 CTGTGGGTTTGGGTGTATTTGGG + Intronic
934006251 2:87767566-87767588 CTGTGGGTTTGGGTGTATTTGGG - Intronic
935221381 2:101016921-101016943 GTGTGGGGTTGGGGGGATGGGGG + Intronic
935769901 2:106408456-106408478 CTGTGGGTTTGGGTGTATTTGGG - Intronic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
935910192 2:107887467-107887489 CTGTGGGTTTGGGTGTATTTGGG + Intronic
935968311 2:108504313-108504335 CTGTGGGTTTGGGTGTATTTGGG + Intronic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936131984 2:109852608-109852630 CTGTGGGTTTGGGTGTATTTGGG + Intronic
936212713 2:110518877-110518899 CTGTGGGTTTGGGTGTATTTGGG - Intronic
936421853 2:112373457-112373479 CTGTGGGTTTGGGTGTATTTGGG - Intronic
937978212 2:127594162-127594184 CTGTGCATTTTGGGGGAGGCAGG - Intronic
938493339 2:131777154-131777176 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
938782238 2:134595258-134595280 TTGTGGGGTTGGGGGGAGTGGGG - Intronic
938837092 2:135115940-135115962 CTGTGGGGTTGGGGGGAATGGGG + Intronic
939123291 2:138144127-138144149 CTTTTGGTTTGGGGGGTGGCAGG - Intergenic
939261809 2:139820429-139820451 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
939408399 2:141790457-141790479 CTGTGGGGTGGAGGGTAGGTAGG + Intronic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
940761408 2:157742888-157742910 CAGTGGGATAGGGTGGAGGTTGG - Intronic
940785003 2:157971800-157971822 CTTTGGGTTGGGTGGGAGCTGGG - Intronic
940809727 2:158228805-158228827 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
941056584 2:160796326-160796348 GTAAGGGTTTGGGGGGAAGTGGG + Intergenic
941070697 2:160951288-160951310 TTGTGGGGTTGGGGGGTGGCGGG + Intergenic
941139955 2:161767916-161767938 CTGAGGTTTTGGGGGAAGATTGG - Intronic
941175747 2:162195511-162195533 CTCCCGGGTTGGGGGGAGGTAGG + Intronic
941258108 2:163259196-163259218 TTGTGGGTTTAGGGGAAGGAGGG - Intergenic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
942460817 2:176167254-176167276 TTGTGGTTTGGGTGGGAGGTAGG + Intronic
942512919 2:176722082-176722104 TTGTGGGGTTGGGGCGAGGTAGG + Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943116334 2:183676298-183676320 ATGGGGGTTTGGGGGCAGGAGGG + Intergenic
943785632 2:191875487-191875509 CAGTGGCTTTGTGGAGAGGTTGG + Intergenic
943869473 2:192975642-192975664 CAGTGGCTTAGGGGGTAGGTGGG - Intergenic
944667144 2:201967815-201967837 GTGGGGGTTTGGGTGGAGGGTGG - Intergenic
945062952 2:205924602-205924624 CTGGGGGGCTGTGGGGAGGTGGG + Intergenic
945072329 2:206004339-206004361 CTGTGTGTTTGCAGGCAGGTGGG - Exonic
945253000 2:207779979-207780001 CGGTGGGTTTGGGGGTATTTGGG - Intergenic
945266162 2:207893317-207893339 CTTTGGGTTTTGGGGGAGCAGGG + Intronic
946137274 2:217657554-217657576 CTGTGGGCTTGGCGAGAGCTGGG - Intronic
946228807 2:218279209-218279231 CTGGGGGTGTGGGTGGCGGTGGG - Intronic
946305961 2:218857292-218857314 TTGGGGGGTCGGGGGGAGGTGGG - Intergenic
946322830 2:218963389-218963411 CTCTTGGTTTGGGAGGAGGGAGG + Intergenic
946435340 2:219648129-219648151 CTGGGGTTTTGAGGGGATGTCGG - Intergenic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
947305484 2:228741560-228741582 TGGTGGGGTTGGGGGGAGGGGGG - Intergenic
947916092 2:233832744-233832766 CTGTGGGGTTTCGGGGGGGTGGG + Intronic
948002321 2:234578346-234578368 GTGTGTGTTTTGGGGGAGGAGGG - Intergenic
1168805923 20:672282-672304 CTGTGGGCTTGGGGGGACCCTGG + Intronic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1170907244 20:20527591-20527613 TTGGGGGTGTGGGGGGAGGGCGG - Intronic
1171502281 20:25603309-25603331 CTCTGGGTTTGGGTGAAGGAAGG - Intergenic
1171963653 20:31513978-31514000 CAGTGTGTGTGGGGGGACGTTGG - Intergenic
1172190455 20:33059272-33059294 CTGTGGGTTTGAGGTGAGATAGG + Intronic
1172754415 20:37273217-37273239 CTGGGGGTTTGGGGGGGCGGTGG + Intergenic
1172800960 20:37575926-37575948 CTGAGGGTTTTGGGAGAGGGAGG + Intergenic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1172952110 20:38728860-38728882 CCCTGGTTTTGGGGGGAGGCGGG + Exonic
1173009356 20:39167780-39167802 CAGTGGGTTAGGGAGGAGGTAGG - Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173578969 20:44132835-44132857 CTGCAGGTGTGGGGGGCGGTGGG - Intronic
1173591922 20:44231485-44231507 CTGTGGGTTGGGTGTGAGCTTGG - Intergenic
1173824168 20:46036804-46036826 CTGGGGCTTTGTGGGGAGGGAGG + Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174597747 20:51698123-51698145 CTGAGACTTTGGGGGAAGGTGGG - Intronic
1174689852 20:52493118-52493140 CTGTGTGTTTGGGGACGGGTAGG + Intergenic
1174750178 20:53104243-53104265 CTGGGGGGTGGGGGGAAGGTGGG + Intronic
1174766790 20:53262146-53262168 CTGTTTGTTTGGTGGCAGGTTGG - Intronic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175260487 20:57670901-57670923 TTGGGGGTTGGGGGGGCGGTGGG - Intronic
1175328753 20:58148236-58148258 ATGTGGCTTTGGGTGGAAGTGGG - Intergenic
1175508665 20:59506136-59506158 GTGTGGGTTTTGGGGGAACTTGG + Intergenic
1175753208 20:61513434-61513456 CTGTGGGGTTGCTGTGAGGTTGG - Intronic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1176316733 21:5252954-5252976 TTGTGGGGTTGGGGGGATGGGGG - Intergenic
1176614562 21:9017233-9017255 CTGTGGGCTTGGGGTGAGCCAGG + Intergenic
1177132985 21:17279800-17279822 CTGGGGGTGTGGGGGGGGGGGGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1177401430 21:20610638-20610660 ATGGAGGGTTGGGGGGAGGTGGG + Intergenic
1177708235 21:24736979-24737001 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1178153970 21:29830298-29830320 GTGTGTGTGTGTGGGGAGGTGGG - Intronic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1179518815 21:41928688-41928710 CTGCGGGATTGGGGGGTGGGGGG - Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179921966 21:44512333-44512355 CTGTGGGGGTGGGGTGGGGTGGG + Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180294730 22:10873791-10873813 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180469614 22:15642908-15642930 CTGGCGGTTGGGGGGGGGGTTGG + Intergenic
1180497536 22:15903205-15903227 CTGTGGGCTTGGGGTGAGCCAGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181115642 22:20631337-20631359 CTATGGGTCCTGGGGGAGGTGGG + Intergenic
1182045884 22:27273911-27273933 CGGTGGGGTGGGGGGGAGGGGGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182085769 22:27560244-27560266 CTGAAGGTTTGGGAGGAGGGCGG - Intergenic
1182128913 22:27836415-27836437 ATGCGGGTTTGGGGGAAGGAGGG - Intergenic
1182353419 22:29711287-29711309 CTGGGGGATGGGGGTGAGGTTGG - Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182857180 22:33528110-33528132 CTGTGGGTTCTGGCAGAGGTCGG + Intronic
1182857949 22:33534702-33534724 TTCTGGGTTTGGGGAGAGGATGG + Intronic
1183108274 22:35630051-35630073 CTGTGGTTGTGGGGTGGGGTGGG + Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183548001 22:38465626-38465648 GTGTGTGTTGGGGGGGACGTGGG - Intergenic
1183548026 22:38465710-38465732 CTCTGGCTTGGGGAGGAGGTGGG + Intergenic
1183717499 22:39542187-39542209 CTGTGAGTTTGGGTGGGGGCTGG - Intergenic
1184058424 22:42067442-42067464 GTGTGTGTTGGGGGAGAGGTGGG - Intronic
1184729122 22:46363553-46363575 TTGTGAGTTTGGAGGGAGGGAGG + Intronic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185297975 22:50063669-50063691 CTGTGGGTTTCAGGGGTGCTGGG - Intronic
1185298069 22:50063934-50063956 CTGTGGGGTGGGGGGAAGCTGGG - Intronic
949326309 3:2868839-2868861 TGGTGGGTTTGGGGGGTGGTGGG + Intronic
949360078 3:3222186-3222208 CTGTGATTTTCAGGGGAGGTGGG + Intergenic
950636363 3:14317984-14318006 GTGTGTGTTTGTGTGGAGGTCGG + Intergenic
950671765 3:14531628-14531650 CAGTGGCCTTGGGAGGAGGTAGG + Intronic
951190990 3:19771410-19771432 CTGTGGATCTGGGGGAAGATTGG - Intergenic
951291200 3:20874060-20874082 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
951630699 3:24716727-24716749 AGGTGGGATTGGGGGGAGGAAGG + Intergenic
951657304 3:25023870-25023892 ATGTGGGTGTTTGGGGAGGTGGG + Intergenic
952132191 3:30377601-30377623 CTGGGGGTTGAGGGGGAGGTGGG - Intergenic
952261738 3:31746820-31746842 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
952404712 3:32995038-32995060 CTCTGGCTTTGGAGGGAGGTAGG + Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
952942584 3:38455143-38455165 ATGTGTGTTTGGGGGTATGTGGG + Intronic
953397097 3:42581995-42582017 ATGCGGGGTAGGGGGGAGGTGGG - Intronic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
953935371 3:47037275-47037297 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
954056111 3:48027359-48027381 CTCTGGGCTTGGTGGGAGTTGGG - Intronic
954316913 3:49806282-49806304 GTGGGGGGTGGGGGGGAGGTGGG + Intronic
954543838 3:51416002-51416024 CTGTGGGTTTGGGCCTGGGTAGG - Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
955058268 3:55474771-55474793 AGGTGGGGTTGGGGCGAGGTAGG + Intronic
955387233 3:58489401-58489423 CTGTTGGTTTGGGGGGTTGGGGG - Intergenic
955588685 3:60510709-60510731 TTGTGTGTGTGGGGGGAGGTGGG - Intronic
955822281 3:62908780-62908802 TTGTGGGGTTGGGGGGGGATGGG + Intergenic
956322374 3:68011119-68011141 GTGTGTGTGTGGGGGGTGGTGGG + Intronic
956326824 3:68062177-68062199 TTCTGGGGTTGGGAGGAGGTAGG + Intronic
956674656 3:71722778-71722800 GTGTGGGTATGGGGAGGGGTTGG + Intronic
956838479 3:73115295-73115317 TTGCGGGTTTGGGTGGGGGTGGG + Intergenic
956976785 3:74589954-74589976 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
957150314 3:76478172-76478194 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957327993 3:78720941-78720963 TTGTGGGGTTGGGGGGGGGGCGG + Intronic
957367299 3:79242977-79242999 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957646765 3:82939971-82939993 TTGGGGGGGTGGGGGGAGGTTGG - Intergenic
958635582 3:96739950-96739972 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
958825346 3:99022996-99023018 CTGTGTGTTGTTGGGGAGGTGGG + Intergenic
959119657 3:102217572-102217594 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
959260364 3:104071697-104071719 CTGTGGGTGTGTGGGTGGGTGGG + Intergenic
959589669 3:108064259-108064281 GTGTGTGTTTGAGGGGAGGGGGG + Intronic
959827401 3:110814853-110814875 ATGAGGGTTTGAGAGGAGGTGGG - Intergenic
959937277 3:112042083-112042105 GAGTGGGTTTGCGGGGAGGTGGG + Intronic
960047509 3:113212067-113212089 CTGTTGGTTCGGGGAGAGGAGGG + Intronic
960456881 3:117883104-117883126 TTGTGGGGTTGGGGGGAGTGGGG + Intergenic
960713058 3:120550227-120550249 GTGTTGGTGTGGGGGAAGGTTGG + Intergenic
960942189 3:122942417-122942439 GTGTGGGGTTGGGGAGAGGATGG - Intronic
961029228 3:123587497-123587519 GTGTGTGTTGGGGGGGGGGTGGG - Intergenic
961029928 3:123592924-123592946 CTATGGGTGTGGGAGGAGGCTGG - Intergenic
961088551 3:124090646-124090668 CTCAGGGTGTTGGGGGAGGTGGG + Intronic
961161081 3:124726644-124726666 GTGGGGGGTTGGGGGGACGTGGG - Intergenic
961384265 3:126515648-126515670 CTGGGGGTTAGGGGGAGGGTAGG - Intronic
961418807 3:126783088-126783110 CTATGGGGTAGGGGAGAGGTAGG - Intronic
961479452 3:127170758-127170780 AGGTGGGCTTGGGGGGAGGTGGG + Intergenic
961507769 3:127382522-127382544 GTTTGGGTTTGGTGAGAGGTGGG + Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961823847 3:129588598-129588620 CAGTGGGTTGGGGGGGACTTGGG + Intronic
962428664 3:135298765-135298787 CTGTGGGTTGATGGGGAGATGGG + Intergenic
962741222 3:138363821-138363843 CTGTGGTTTGGGGGGGGGGGGGG - Intronic
962939779 3:140115396-140115418 CTGTGGGTGGGTGGGTAGGTGGG + Intronic
963603755 3:147397408-147397430 CTGTGGGGGTGGGGTGAGGGAGG - Intronic
963733477 3:148993302-148993324 CTGTTGGTTTGGGCGGGGGGAGG + Intronic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964538909 3:157757131-157757153 CTGTGGGGTAGGGCGGAGGTGGG + Intergenic
965668313 3:171119794-171119816 TTGTGGGGTTGGGGGGAGGGAGG + Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
965910504 3:173769398-173769420 ATGTGTGTTTGGGGGAATGTTGG - Intronic
965941479 3:174187856-174187878 TTGTGGGTTTGTTGGGAGGGTGG + Intronic
966302032 3:178489901-178489923 TTTTGGGTATGGGTGGAGGTGGG - Intronic
966890819 3:184406326-184406348 CAGTGGGTGTGGGTGGGGGTGGG - Intronic
967220275 3:187242720-187242742 CTGGGGGTTTGGGAGGAACTGGG - Intronic
968185378 3:196630108-196630130 CTGGGGGTTTGGGGGAAAATGGG - Intergenic
968373377 4:15948-15970 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
968579537 4:1383503-1383525 CTGTGGGGGTGTGGGGCGGTGGG + Intronic
968887298 4:3341528-3341550 ATGGGGGTGTGGGGGGAGGGAGG + Intronic
968912325 4:3482687-3482709 CTGTGTGTTTGGGGAAAGGGGGG - Intronic
968926622 4:3551737-3551759 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
969192445 4:5533189-5533211 ATATGGGTTGGGGAGGAGGTGGG + Intergenic
969254036 4:5990524-5990546 CTGTGGCTTTGGGAGGAGGCGGG + Intergenic
969268437 4:6081483-6081505 CTGGTGCTTTGTGGGGAGGTGGG + Intronic
969311068 4:6353487-6353509 CTGTCGGTGTGGGGGGTTGTTGG - Intronic
969311074 4:6353503-6353525 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311135 4:6353699-6353721 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311145 4:6353731-6353753 CTGTCGGTGTGGGGGGCTGTTGG - Intronic
969311209 4:6353927-6353949 CTGTTGGTGTGGGGGGCTGTCGG - Intronic
969315846 4:6380966-6380988 CCCTGGGTCTGGTGGGAGGTGGG - Intronic
969352887 4:6608328-6608350 CTGTGGGATTGTGGTGAGGGTGG - Intronic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
970970014 4:21971525-21971547 CTTTGGGTATGGTGGGAGCTGGG + Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971409485 4:26355168-26355190 CTGGGGGATTAGGGGGAGGTGGG - Intronic
971451509 4:26805641-26805663 CTGTAGGTAAGGGTGGAGGTGGG - Intergenic
971537553 4:27772526-27772548 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
971771259 4:30899763-30899785 TTGTGGGGTGGGGGTGAGGTGGG + Intronic
971837425 4:31786529-31786551 CGGTGGGGTTGGGGGTAGGGGGG - Intergenic
971929113 4:33055592-33055614 TTGTGGGGTTGGGGTGGGGTGGG - Intergenic
972574061 4:40335575-40335597 CTATTGCTTTGGTGGGAGGTGGG + Intronic
972595664 4:40527754-40527776 GTGTGTGTTTGGGGGGTGGGGGG + Intronic
972625045 4:40788777-40788799 GTGTAGGTTTGGGGGCAGGGAGG + Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973558828 4:52113553-52113575 CTGTAGCTTTGGGTCGAGGTGGG + Intergenic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
975025365 4:69542221-69542243 CTGTGGGTTTGTGGGGTGGGAGG - Intergenic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975515307 4:75240834-75240856 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
975529722 4:75387691-75387713 TTGTGGGTTGGGGAGGGGGTAGG - Intergenic
975767789 4:77687188-77687210 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
976606476 4:86987996-86988018 CTCTGGGGTTGGGGGGTGGGCGG - Intronic
976745904 4:88402758-88402780 CTGTGCATTTGGGAGGAGCTAGG + Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977745127 4:100537659-100537681 TGGTGGGATTGCGGGGAGGTGGG + Intronic
977889383 4:102290784-102290806 CTGTGGGGTTGGGGAAAAGTGGG - Intronic
978417972 4:108498699-108498721 AAGTGGGTTTGGGGAGATGTTGG + Intergenic
978512990 4:109541796-109541818 CTGTGGGTGGGGGGTGGGGTGGG - Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979279253 4:118846901-118846923 CCGTGTGTGTGGGTGGAGGTGGG - Intergenic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
980447742 4:132932827-132932849 TTGGGGGTTGTGGGGGAGGTGGG + Intergenic
980634431 4:135481322-135481344 CTTTGGGTTTGGGAGGGGTTAGG - Intergenic
981042124 4:140233170-140233192 CGGTGGGGGTGGGGGGGGGTGGG - Intergenic
981050122 4:140301329-140301351 CTGTGGATTTAGGGGGAATTAGG + Intronic
981051039 4:140309805-140309827 CTGTGGGGTTTGGGGGAGACAGG - Intronic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981508129 4:145525601-145525623 CTCTGGGTTTGGGCTGGGGTGGG + Intronic
983154052 4:164322429-164322451 GTGGGAGGTTGGGGGGAGGTGGG + Intronic
983259489 4:165440451-165440473 TTGTGTGTGTGGGGGGGGGTGGG - Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
983902947 4:173155948-173155970 CTGTGGGTTTGCTGAGGGGTGGG - Intergenic
983953426 4:173669478-173669500 GTGTGGGTTTTGGAGGAGGATGG + Intergenic
984528225 4:180882685-180882707 GTGGGGGGTTGGGGGCAGGTAGG - Intergenic
984715283 4:182918832-182918854 CGGTGGATTTGGGAGGAGGAGGG - Intergenic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
985378796 4:189370917-189370939 CTGTGGGTTTGGGAGAGTGTGGG + Intergenic
985861107 5:2471340-2471362 CTGGGGGGTTGGGGGAAGGCTGG + Intergenic
985889649 5:2705616-2705638 TTATGGGTTTCTGGGGAGGTGGG + Intergenic
986195438 5:5533404-5533426 CAGTGGCTCTGTGGGGAGGTCGG + Intergenic
986323221 5:6650787-6650809 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
986347169 5:6846197-6846219 CTCGGGGCTTGGGGGGAGGGGGG - Intergenic
986440744 5:7779571-7779593 GTGTGTGTTGGGGGGGGGGTTGG - Intronic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986595385 5:9416499-9416521 CTCTGGGGTAGGGGCGAGGTAGG - Intronic
987130196 5:14853096-14853118 GTGGTAGTTTGGGGGGAGGTTGG - Intronic
987376761 5:17242901-17242923 CTTTGTGTTTGGGGGCAGGGAGG + Intronic
987750285 5:22030110-22030132 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
988086567 5:26481897-26481919 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
988226260 5:28415001-28415023 CTAAGGGTTGGGGGGGAGGAAGG + Intergenic
988483500 5:31649015-31649037 CTCTGGGTTGGGGGGCAGGAGGG - Intronic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989254196 5:39349018-39349040 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
989322384 5:40151415-40151437 GTGTGGGTTTTGGGGGTGGAGGG - Intergenic
990089171 5:52019609-52019631 TTGTGGGATGGGGGGGAGGGGGG + Intronic
990903332 5:60777105-60777127 AGGGGGGTTGGGGGGGAGGTGGG + Intronic
992259578 5:74956350-74956372 CTCTTGGTTAGGTGGGAGGTTGG + Intergenic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
994369831 5:98955437-98955459 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
994401832 5:99290064-99290086 TTGTGGGGTTGGGGGAAGGGGGG - Intergenic
994526227 5:100908423-100908445 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
994914814 5:105961855-105961877 ATGTGAGTTGGGGGGGAGATGGG - Intergenic
995049760 5:107688662-107688684 CTGTTTGTTTGGGGGAAAGTAGG + Intergenic
995847783 5:116512693-116512715 CTGTGTGTTTGGGGTGGGGGTGG - Intronic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996148149 5:120000588-120000610 TTGTGTGTGTGTGGGGAGGTCGG + Intergenic
996241438 5:121208109-121208131 CTGTCGGGTGGGGGGGAGGGGGG - Intergenic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996644249 5:125795427-125795449 GTGTGTGTTGGGGGGGAGGTGGG - Intergenic
997355893 5:133262845-133262867 CAGGTGGTGTGGGGGGAGGTGGG + Intronic
997738917 5:136236601-136236623 ATGTGGGTGTGTGGGAAGGTTGG + Intronic
997799358 5:136844156-136844178 TTGTGGGGTAGGGGGAAGGTAGG - Intergenic
997833070 5:137169193-137169215 GTGAGGGGTTGGGGGGAAGTGGG + Intronic
998136253 5:139676184-139676206 AGGAGGGCTTGGGGGGAGGTGGG - Intronic
998136362 5:139676464-139676486 AGGAGGGCTTGGGGGGAGGTGGG - Intronic
998247509 5:140520776-140520798 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
998540179 5:142973831-142973853 CCGTTGGTTTAGGGGGAGGTGGG + Intronic
998726234 5:145017864-145017886 TTTTGGGTCTGGGTGGAGGTGGG - Intergenic
999548115 5:152654104-152654126 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
1000341849 5:160283752-160283774 GTGGGGGTTGTGGGGGAGGTGGG - Intronic
1000858654 5:166430597-166430619 CTGCCGGGTTGGGGGGAGGGGGG - Intergenic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001381840 5:171310709-171310731 CTGTGTGTTTGGGGCGGGGGTGG - Intronic
1001996848 5:176168750-176168772 CTGTAGGTTGAGGGAGAGGTAGG + Intergenic
1002066126 5:176652629-176652651 CTCTGGGTCTTGGTGGAGGTAGG + Intronic
1002140084 5:177133062-177133084 GTGTGGGTTTGGGGTGCGGCCGG + Intronic
1002278291 5:178116811-178116833 GTGTGCATTTGGGGTGAGGTGGG + Intronic
1002381371 5:178832072-178832094 CTGGGGGAGGGGGGGGAGGTGGG - Intergenic
1002570740 5:180137980-180138002 CTGTGGGCTCGGTGGGGGGTGGG + Exonic
1003002806 6:2351695-2351717 CCGGGGGTTCGGGGGGAAGTGGG - Intergenic
1003021200 6:2511046-2511068 CTGTGTGTTTGCGGGGACGGGGG - Intergenic
1003145242 6:3504858-3504880 CTGCTGGCTGGGGGGGAGGTGGG + Intergenic
1003243859 6:4367967-4367989 CTGTGGGTTTGTGATGAGGCTGG + Intergenic
1003847937 6:10193189-10193211 CTGGTGGGTTGGGGCGAGGTGGG + Intronic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004256054 6:14065600-14065622 TTGTGTGTGTGGGGGGGGGTGGG + Intergenic
1005111359 6:22285352-22285374 TTGGGGGGGTGGGGGGAGGTTGG + Intergenic
1005177642 6:23064813-23064835 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1005812895 6:29530106-29530128 CTGTGGGGTGGGGGTGAGCTGGG - Intergenic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1005914377 6:30339998-30340020 GTTTGGGTTGGGGGTGAGGTTGG + Intronic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006648883 6:35534850-35534872 CTGGGGGTTTGGGGGAAGAGGGG - Intergenic
1007382516 6:41499839-41499861 CTGGGACTTTGGGGGGAGGGCGG + Intergenic
1007397038 6:41583772-41583794 CTGGGGGGTTCAGGGGAGGTGGG + Intronic
1007801852 6:44401246-44401268 CTGAGTGTTTGGTGGGAAGTAGG + Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008495114 6:52125261-52125283 TTTTGTATTTGGGGGGAGGTGGG + Intergenic
1008503233 6:52204418-52204440 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1008511600 6:52281198-52281220 TTGCGGGTTTGGGAGCAGGTTGG - Intronic
1008847662 6:55987366-55987388 CTGGGGGTTTGGGGGAAGTGGGG - Intergenic
1008875240 6:56318909-56318931 GTGTGTGTTTGGGGGGAGGTGGG - Intronic
1009499753 6:64395629-64395651 TTGTCGGGTTGGGGGGAGGGGGG + Intronic
1009512046 6:64564781-64564803 CTGTAGGTTGGGGTGGGGGTCGG + Intronic
1009673057 6:66781144-66781166 GTGGGGGGTTGAGGGGAGGTGGG + Intergenic
1009944168 6:70323555-70323577 TTGTGGGGTTGGGGGGAGAGGGG + Intergenic
1010054573 6:71550643-71550665 ATATGTGTTTGGGGGGAAGTGGG - Intergenic
1010877296 6:81123392-81123414 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1011394483 6:86891822-86891844 CTGTGGGTTTTGGGGGATAGGGG - Intergenic
1012060852 6:94478474-94478496 ATGATAGTTTGGGGGGAGGTGGG + Intergenic
1012375926 6:98561491-98561513 CTCTGGGTTTAAGAGGAGGTAGG - Intergenic
1012807895 6:103918026-103918048 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1012967961 6:105695871-105695893 CTGCTGGTTTGGCTGGAGGTAGG + Intergenic
1013135281 6:107276408-107276430 GTGTGTGGTTGGGGGGAGGGTGG + Intronic
1014098342 6:117483121-117483143 CTCTGGTTTTGGGGGAAGGAAGG - Intronic
1014973445 6:127848063-127848085 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1015080521 6:129219824-129219846 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1015497062 6:133893180-133893202 CTGTGGGGTTGGTGGAAGGGCGG - Exonic
1015739519 6:136438832-136438854 CTGGGGGTTGGGGGGAAGGGAGG - Intronic
1015828722 6:137344659-137344681 CAGTGGGGTTGGGGGTATGTTGG + Intergenic
1015886782 6:137926032-137926054 CTGGGGGTTAGGGAGGAAGTGGG - Intergenic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1016460014 6:144272162-144272184 GGGTGGGTATGGGGAGAGGTAGG + Intergenic
1016660891 6:146578570-146578592 TTGTGGGGTTGTGGGGAGGGGGG - Intergenic
1016869586 6:148803668-148803690 CTGAGGGTTTGGGGGCAGTGTGG - Intronic
1017980646 6:159398335-159398357 CAATGGGTTTGGGGTGGGGTGGG + Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018832403 6:167453741-167453763 CTGTGGCTTTCAGGGGAGATTGG + Intergenic
1019016830 6:168886068-168886090 CTCTTTGTTTGGGGTGAGGTGGG - Intergenic
1019127275 6:169849202-169849224 CTGTGGGTTTGGGGTGCTGCCGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1020021781 7:4873655-4873677 GTGTCGCTTTGGGGGAAGGTGGG - Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020342871 7:7131510-7131532 CTGAGGGCTTGAGGGGAAGTAGG - Intergenic
1020440403 7:8211152-8211174 CTGTGGGTTCTCTGGGAGGTTGG - Intronic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021404475 7:20248817-20248839 CTGTGGATTTGGGGTAAGGGAGG - Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1023027052 7:36060331-36060353 TTGGGGGATTGAGGGGAGGTGGG + Intergenic
1023055050 7:36284427-36284449 TTCTGTCTTTGGGGGGAGGTGGG - Intronic
1023319242 7:38975863-38975885 CTGGGGGTGTGGGTGGAGGTGGG - Intergenic
1023494231 7:40777632-40777654 CTGTGGGTCTGGGGAAAGCTGGG + Intronic
1023938694 7:44756834-44756856 AAGTGGGTTGGGGGAGAGGTGGG - Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1025886273 7:65597043-65597065 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1026092124 7:67308997-67309019 CTGTGAGTTTGTGGGGACATTGG + Intergenic
1026131265 7:67622709-67622731 GTGGGGGATTGGGGTGAGGTTGG + Intergenic
1026196695 7:68179675-68179697 CTCTGGGTTTTGTGGGGGGTGGG - Intergenic
1026456296 7:70575408-70575430 CTGAGGGTGGGGGTGGAGGTGGG - Intronic
1026869106 7:73840123-73840145 GTGTGTGTGTGGGGGGGGGTGGG + Intronic
1026913577 7:74106788-74106810 CTGAGGGGTTGAGGGGAGCTGGG + Intronic
1027522675 7:79229939-79229961 CTGTGAGGGTGGGGGGAGGGGGG - Intronic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027723178 7:81770251-81770273 GCGTGGGGTTGGGGGGAGGCGGG - Intronic
1027960434 7:84939662-84939684 CTGTGGCCCTGGGGGTAGGTGGG + Intergenic
1027967943 7:85038043-85038065 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1028009334 7:85620640-85620662 CTGGGGCTTTGGGGGGTGGAGGG + Intergenic
1028239278 7:88399432-88399454 CTGTGGGTTTGAGGGGCTGAGGG + Intergenic
1028634525 7:92972264-92972286 CTAGGGGTGTGGGTGGAGGTTGG + Intergenic
1029045984 7:97629228-97629250 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1029440469 7:100584361-100584383 CTGTGAGCTTGGGGGGGGGTCGG - Intronic
1029491087 7:100870475-100870497 CTGTGGGGTGGGTGGGACGTGGG + Intronic
1029909368 7:104128669-104128691 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1029998295 7:105031354-105031376 CTGAGGATTGGGGGGGTGGTGGG + Intronic
1030590157 7:111470721-111470743 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1031144743 7:117985394-117985416 TTGTGGGGTTGCGGGGAGGGGGG + Intergenic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032091219 7:128912608-128912630 ATGTGTGTTTGGCTGGAGGTGGG + Intergenic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032652869 7:133897990-133898012 GGGTGGGTGTGGGGTGAGGTGGG - Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1033326983 7:140388077-140388099 ATGGGGGTTTGGGGAGATGTTGG - Intronic
1033908409 7:146235255-146235277 TGGTGGGTTTTGGGGGAGGGTGG + Intronic
1034463076 7:151209295-151209317 TTGTGGGGTTGGGGGTGGGTGGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034716835 7:153251219-153251241 CTGGGGGGTTGGGGAGAGCTGGG + Intergenic
1035259852 7:157654173-157654195 GGGTGGGTGTGGGGAGAGGTGGG - Intronic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1036381257 8:8237850-8237872 CAGTGGCTTTGGGAGGGGGTCGG - Intergenic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1037062538 8:14532702-14532724 CTTTGTGTGTGGGGGGAGGGCGG + Intronic
1037416717 8:18659110-18659132 CTAGGGGGTTGTGGGGAGGTGGG + Intronic
1037496271 8:19443877-19443899 CTGGGGGTGGGGGTGGAGGTGGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037511838 8:19591155-19591177 CTGTGGCTTTGTGAGGAGGTGGG - Exonic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1038691094 8:29764333-29764355 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1038863376 8:31412193-31412215 CAGGGGGTCTAGGGGGAGGTGGG + Intergenic
1039352234 8:36775422-36775444 TTGTGGGGTTGGGGGGAGTGGGG + Intergenic
1040017090 8:42708525-42708547 GTGTGTGTTTGGAGGGAGGTGGG + Intronic
1040596995 8:48847985-48848007 CTGTGGGTCTGGGGAGGGGTGGG + Intergenic
1040895628 8:52365687-52365709 TTTTGGGTTTGGGGGGTGGGGGG + Intronic
1041023873 8:53664983-53665005 CTGTGGGGGTGGGGTGGGGTAGG - Intergenic
1041276604 8:56166363-56166385 CTGTGTTTGTGGGGGGAGCTGGG + Exonic
1041406227 8:57502188-57502210 GTGTGGGGTTGGGGGCAGGCAGG + Intergenic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1042179117 8:66067196-66067218 ATGTGGGGGTGGGGGGCGGTGGG - Intronic
1042344125 8:67710400-67710422 GTGGGGGGTTGGGGGGGGGTGGG - Intronic
1042385895 8:68174364-68174386 GTTTGGTGTTGGGGGGAGGTAGG - Intronic
1042556206 8:70035354-70035376 CTGTTGGTTTTGGGGGCGGAGGG - Intergenic
1043534983 8:81192986-81193008 CTGGGGACTCGGGGGGAGGTTGG - Intergenic
1044255326 8:90053498-90053520 TTGTGTGTTTGGTGAGAGGTGGG - Intergenic
1044776827 8:95698747-95698769 GTGTGTGTTTGGGGGAGGGTGGG - Intergenic
1044824388 8:96182573-96182595 CCCTGGGTTTGGAGGGAGGGTGG - Intergenic
1045154995 8:99458061-99458083 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1046530772 8:115442595-115442617 GTGTGTGTTTGGGGGAAGGAAGG + Intronic
1047180718 8:122585171-122585193 CTGTGGGGTGGGGGGGTGGGGGG - Intergenic
1047641797 8:126828559-126828581 CTATGGGTGTGGTGGGAGTTGGG - Intergenic
1047758043 8:127933637-127933659 CTCTGGGTTTGGTGGGACCTTGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048695800 8:137026389-137026411 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1048837789 8:138537628-138537650 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1048987676 8:139743739-139743761 CTGTGGGGTGGGGGGCAGGCAGG + Intronic
1049171755 8:141165878-141165900 CTTTGAGGATGGGGGGAGGTGGG - Intronic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049392654 8:142380169-142380191 CTGTGGAGTTGTTGGGAGGTGGG - Intronic
1049619616 8:143592119-143592141 TTGTGGGTTGGGGGTGGGGTGGG + Intronic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1050599696 9:7238000-7238022 TTGTGGCTTTGTGGGGAGGAGGG + Intergenic
1050831529 9:10019774-10019796 TTGTGGGGTGGGGGGGAGCTGGG + Intronic
1051088286 9:13377513-13377535 CAGTTGGGTTGGGGGGAGGAAGG + Intergenic
1051196196 9:14565103-14565125 CTGTGGGGTTGGGGTGGGCTGGG + Intergenic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1052167668 9:25352948-25352970 CTGTGTGTTTGTGGAGAGTTAGG - Intergenic
1052206604 9:25848710-25848732 GTGTGGGGTTGGGGGGTGGGGGG - Intergenic
1052381460 9:27775447-27775469 GTGTGGGGTTGGGCGGGGGTGGG - Intergenic
1052417837 9:28201222-28201244 TGGTGGGGTTGGGGGGAGGGGGG - Intronic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1053062082 9:35039996-35040018 CTGTAGTTTTGGATGGAGGTTGG - Intergenic
1053163889 9:35831173-35831195 CTGAGGGATTGTGGGGAGGCTGG + Intronic
1053307553 9:36995127-36995149 GTGTGGCTTTGGGGGCAGGAAGG - Intronic
1053801541 9:41767119-41767141 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054143658 9:61547707-61547729 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054189972 9:61979273-61979295 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054463434 9:65479042-65479064 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054648542 9:67609318-67609340 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1055300600 9:74878066-74878088 CTGTGGTGTTGGTGGCAGGTTGG - Intronic
1055640404 9:78314973-78314995 CTGTGGTTCTGTGTGGAGGTGGG + Intronic
1055709939 9:79049842-79049864 CTGTAGATTAGTGGGGAGGTGGG - Intergenic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1055990978 9:82105252-82105274 CTGTGTGTTGGGGGCGGGGTTGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056193394 9:84206398-84206420 TTGTGTGTGTGGGGGGTGGTTGG + Intergenic
1056280805 9:85039656-85039678 CTGGGGGTTGGGGGTGGGGTGGG - Intergenic
1056374569 9:85994316-85994338 GTGAGGGTTTGTGGGGAGGAGGG - Intronic
1057103956 9:92392610-92392632 ATGTCGGGTTGGGGGGAGGGGGG + Intronic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057746511 9:97756494-97756516 CTAGGGGTTTGGGAGGAAGTGGG - Intergenic
1057777058 9:98019831-98019853 CTTTGGGTTTGGGCAGAGCTGGG - Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058187429 9:101871419-101871441 CTGTGGGAGTCGGGGGTGGTGGG - Intergenic
1058432072 9:104928354-104928376 CTAGGGAGTTGGGGGGAGGTGGG + Intergenic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058906734 9:109488065-109488087 GTGTGGGGTCGGGGGGAGGAGGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059705459 9:116819213-116819235 CTGTGTGTTTGGGGTGGGGTGGG - Intronic
1060024783 9:120161908-120161930 GCGTGGGATTGGGAGGAGGTGGG + Intergenic
1060190428 9:121588967-121588989 CCTTGGGTTTGGTGGGGGGTAGG - Intronic
1060215574 9:121736536-121736558 CTGTGGGGTGGGGGGCGGGTGGG + Intronic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062139218 9:134946101-134946123 CTGGGGGTGTGGGGTGGGGTTGG + Intergenic
1062284855 9:135768336-135768358 ATGTGGGTTGGGGGGGGGGGGGG + Intronic
1062402914 9:136380262-136380284 CTGGGGGGTTGGGGGCAGGGTGG + Intronic
1062475530 9:136724969-136724991 CTGTGGCCCTGGGGGCAGGTGGG + Intergenic
1062532777 9:137009165-137009187 CTGTGGGGTTGGGGGGCTGTGGG - Intronic
1062614719 9:137391140-137391162 CTGTGGCTGTGGGTGGACGTGGG - Intronic
1062708794 9:137960370-137960392 CGGTGGGGTGTGGGGGAGGTTGG + Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186139508 X:6556198-6556220 GTGTGGGTTCGGGGGGAGACTGG - Intergenic
1186497486 X:10023301-10023323 ATGTGGGGGTGGGGAGAGGTAGG + Intronic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186906547 X:14117090-14117112 GTGGGGGTGTGGGGGGGGGTGGG + Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187625059 X:21102018-21102040 GGGTGGGTTTGGGGGGAGTGGGG + Intergenic
1188027813 X:25229162-25229184 GTGAGGGTTGGGGGGAAGGTAGG + Intergenic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1188370020 X:29358404-29358426 CTGTGTGTGTGGCGGGGGGTGGG - Intronic
1188760161 X:34017799-34017821 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1188862212 X:35271336-35271358 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1188942910 X:36262350-36262372 GTGGGGGGTTGGTGGGAGGTAGG - Intronic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189855819 X:45223903-45223925 GTGGGGGGTTGCGGGGAGGTTGG + Intergenic
1189988361 X:46573580-46573602 CGGAGGGTTTGGGGAAAGGTGGG + Intergenic
1190311930 X:49122859-49122881 CTGTGGGGCTGGGGTGAGTTTGG - Intronic
1190327975 X:49218428-49218450 CTGTGGGTTTGGGTGGGGTGGGG + Intronic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190642844 X:52496402-52496424 CTTTGGGGTGGGGGGGAAGTGGG + Intronic
1190644829 X:52516465-52516487 CTTTGGGGTGGGGGGGAAGTGGG - Intronic
1190741808 X:53293661-53293683 TGCTGGGTTTGGGGGTAGGTGGG - Intronic
1190808843 X:53864376-53864398 CTCTGGGGGTGGGAGGAGGTGGG - Intergenic
1191011615 X:55765563-55765585 TTGTGGGGTCGGGGGGAGGGGGG - Intergenic
1191927061 X:66324746-66324768 GTGTGGGTGTGGGTGGAGATGGG + Intergenic
1192037956 X:67586254-67586276 TTGTGTGTTTGGGGGAAGGAGGG - Intronic
1192048621 X:67702484-67702506 CTGTGCCTTTGGTGGGATGTGGG + Intronic
1192135688 X:68597481-68597503 TCGGGGGTTTTGGGGGAGGTGGG + Intergenic
1192265153 X:69532562-69532584 CTGTGGCTTGGGGAGGGGGTGGG + Intergenic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1193772180 X:85600893-85600915 CTGTGGGTATGGGTAGGGGTAGG + Intergenic
1193846888 X:86482987-86483009 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
1194371421 X:93077744-93077766 TTGGGGGCTTGTGGGGAGGTGGG + Intergenic
1195252568 X:103063494-103063516 TGGTGGGTTTGGGGGCAGGTAGG - Intronic
1195285335 X:103377260-103377282 TGGTGGGTTTGGGGGAAGGGAGG + Intronic
1195409204 X:104550617-104550639 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1195464703 X:105167626-105167648 ATGTGGGTATGTGGGGGGGTGGG - Intronic
1195542083 X:106074388-106074410 TTGGGGATTTGCGGGGAGGTGGG + Intergenic
1195730967 X:107966948-107966970 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1195792822 X:108607482-108607504 CTTGGGGTATGGGGGGAGGGTGG - Intronic
1196140981 X:112263050-112263072 TTTTGGGGTTGGGGGGAGGGGGG + Intergenic
1196337835 X:114559281-114559303 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1196359000 X:114830841-114830863 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1196621291 X:117827592-117827614 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1196820289 X:119695356-119695378 CTTGGGGTTTGGGTGGTGGTGGG + Intergenic
1197571271 X:128153635-128153657 CTGTGCGGTTGGGGGGAGAGGGG + Intergenic
1197876050 X:131108364-131108386 GTGGGGGTTGGGGGAGAGGTAGG - Intergenic
1198097548 X:133395051-133395073 CTGTGGGCTTGCGGGTAGCTGGG - Intronic
1198100160 X:133415747-133415769 CTTTGTGGTTGGGGGGCGGTGGG - Intergenic
1198225520 X:134641636-134641658 CTGTAGCTTAGGGTGGAGGTGGG + Intronic
1198652100 X:138874000-138874022 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1198719632 X:139602255-139602277 GTGTGTGTTGGGGGGGAGGGTGG + Intronic
1198980083 X:142385736-142385758 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1199047812 X:143197630-143197652 GTGGGTGTTTGGGGGAAGGTGGG - Intergenic
1199325910 X:146497989-146498011 TTGGGGGGTTGGGGGGAGGTGGG + Intergenic
1199336367 X:146622486-146622508 CTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1199705534 X:150421862-150421884 CAGTGGGGTTGGGTGGAGCTTGG - Intronic
1199892287 X:152097825-152097847 ATAGGGGTTTGGGGGGAAGTAGG + Intergenic
1200035016 X:153321309-153321331 CTCTGGCTTTCGGGGGAGGAAGG - Intergenic
1200094603 X:153651357-153651379 TGGAGGGTTTGGGGGAAGGTGGG + Intergenic
1200679217 Y:6189622-6189644 TTGGGGGCTTGCGGGGAGGTGGG + Intergenic
1201249802 Y:12045357-12045379 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1201387881 Y:13463010-13463032 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic