ID: 1076980213

View in Genome Browser
Species Human (GRCh38)
Location 11:200097-200119
Sequence CGAGGCTGTCTTCACCAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076980205_1076980213 13 Left 1076980205 11:200061-200083 CCGGCATCTACACAAGATCCGCC 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1076980201_1076980213 24 Left 1076980201 11:200050-200072 CCCCATCACACCCGGCATCTACA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1076980203_1076980213 22 Left 1076980203 11:200052-200074 CCATCACACCCGGCATCTACACA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1076980202_1076980213 23 Left 1076980202 11:200051-200073 CCCATCACACCCGGCATCTACAC 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1076980208_1076980213 -5 Left 1076980208 11:200079-200101 CCGCCGGGCCACAGAGCTCGAGG 0: 1
1: 0
2: 20
3: 23
4: 137
Right 1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1076980204_1076980213 14 Left 1076980204 11:200060-200082 CCCGGCATCTACACAAGATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1076980210_1076980213 -8 Left 1076980210 11:200082-200104 CCGGGCCACAGAGCTCGAGGCTG 0: 1
1: 0
2: 1
3: 46
4: 479
Right 1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076980213 Original CRISPR CGAGGCTGTCTTCACCAGCT GGG Exonic