ID: 1076986921

View in Genome Browser
Species Human (GRCh38)
Location 11:244353-244375
Sequence AACCAAGACACCCTTAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076986921_1076986924 0 Left 1076986921 11:244353-244375 CCCTACCTAAGGGTGTCTTGGTT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1076986924 11:244376-244398 AGCAGAAACCAGTCTGTTGATGG 0: 1
1: 0
2: 1
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076986921 Original CRISPR AACCAAGACACCCTTAGGTA GGG (reversed) Intronic
900823371 1:4907388-4907410 AACTAAGCCACACATAGGTATGG - Intergenic
910986383 1:93008695-93008717 AAACAATTCACCCTGAGGTATGG + Intergenic
915531743 1:156506174-156506196 AACCAATACCCCATCAGGTAAGG - Intergenic
918334908 1:183499142-183499164 AACCAAGATATCCTTCAGTAGGG - Intronic
919208337 1:194447151-194447173 AACCAAGACAACATGAGGGATGG - Intergenic
923341148 1:233008205-233008227 AATCAAGACAACCTTTGGTTGGG + Intronic
924719952 1:246613317-246613339 CACCAACACACCCTGAGGAAAGG - Intronic
1067221658 10:44348260-44348282 AACACAGACACCCTCAGGCAAGG - Intergenic
1069507971 10:69018761-69018783 AGCCAAGTCATCTTTAGGTAGGG + Intergenic
1073571087 10:104581679-104581701 AATCAAGAGACCCTCAGGTTTGG + Intergenic
1076986921 11:244353-244375 AACCAAGACACCCTTAGGTAGGG - Intronic
1077029301 11:456706-456728 AATCCAGGCACCCTTAGGAATGG + Intronic
1077403804 11:2373485-2373507 GATCAAGACACCCGTAGGTTTGG + Intergenic
1079744800 11:24111481-24111503 ATCCAAGACACTCTTGGCTAAGG + Intergenic
1086498701 11:87430445-87430467 AAAGAGGGCACCCTTAGGTAAGG - Intergenic
1088399788 11:109410906-109410928 AAGCCAGACAAACTTAGGTATGG - Intergenic
1103080474 12:118020015-118020037 AACCAAGTCACCATAAAGTAAGG - Intronic
1103280342 12:119753060-119753082 AAGCAAGACATCCAAAGGTATGG + Intronic
1103879809 12:124157405-124157427 AACGAGGACACCATTAGGAAGGG + Intronic
1106581102 13:31018999-31019021 AACCAAAACGCCCAGAGGTATGG - Intergenic
1106994167 13:35461677-35461699 GACCAGGACACTCTTAGGTATGG - Intronic
1108254489 13:48597320-48597342 CAGGAAGACACCCTTATGTATGG - Intergenic
1112840552 13:103572274-103572296 AACAAAGAGAACCTTAGGAAAGG - Intergenic
1116203022 14:41824337-41824359 AACCTACACACCCTTTGGGAGGG - Intronic
1118443941 14:65835350-65835372 AACCAAGACACCATCCGTTAGGG + Intergenic
1118840605 14:69507405-69507427 AACCAAGATGTCCTTAAGTAGGG - Intronic
1120498646 14:85266700-85266722 AGCTAACACACACTTAGGTATGG - Intergenic
1125858399 15:42973842-42973864 AACCTAGATGACCTTAGGTATGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1129432061 15:75506469-75506491 AAGCAAGACACCCAGAGGCAGGG + Intronic
1136998091 16:35204924-35204946 AACTAAGACAGCCTGAGGTATGG + Intergenic
1142062198 16:88037909-88037931 CACCAAGACACCCTCAGACACGG - Intronic
1144135864 17:12294025-12294047 GAGCAAGACACCTCTAGGTAGGG + Intergenic
1149019421 17:51945881-51945903 AACAAAAACACACTTAGGAAAGG + Intronic
1153248546 18:3097361-3097383 AACCAAAACACCCTTGGGTTGGG + Intronic
1153695611 18:7637920-7637942 TACCAAAACCCCATTAGGTAAGG - Intronic
1153842549 18:9020004-9020026 AACCATGACAGCATTAGGCATGG - Intergenic
1156930117 18:42631570-42631592 AACAAAGACAGACATAGGTAAGG + Intergenic
1162623499 19:11863701-11863723 AACCAAGACAACCTTGGATTTGG - Intronic
1163541541 19:17914175-17914197 AATCAAGACTCCCTTAGGCTGGG + Intergenic
926682697 2:15675895-15675917 AGCCAAGACCCCCATAGGGAGGG + Intergenic
933017494 2:77147510-77147532 TACCAAGACACCCTTAACTTGGG + Intronic
938060472 2:128250718-128250740 AACCAAGACACCCTGATTTCAGG - Intronic
938851912 2:135268978-135269000 ACCCTAGACACCCTTATGTGGGG - Exonic
939672885 2:145035261-145035283 AAACAATTCACTCTTAGGTAGGG + Intergenic
939911420 2:147988203-147988225 AACCCAGACGCCCTAAGGAAAGG + Intronic
940941071 2:159561304-159561326 AGCCAAGACACCTTTGGGTTTGG + Intronic
941837080 2:170035246-170035268 AACCTAGATAACCTTGGGTATGG - Intronic
942404970 2:175644523-175644545 AACCTAGATAACCTTGGGTATGG - Intergenic
943791405 2:191936673-191936695 AATCAAGACACCCATAAGTCAGG + Intergenic
945238202 2:207652355-207652377 AACCTAGATACGCTCAGGTATGG + Intergenic
945327803 2:208502854-208502876 AACCTTGACAACCTTGGGTATGG - Intronic
948328218 2:237143434-237143456 AACCAAGACACTATTATGTGAGG - Intergenic
1170550941 20:17475368-17475390 TACCAAAACACCCTTAGCTGTGG + Intronic
1174104321 20:48151451-48151473 AACCAATGCACCCTCAGGTTGGG + Intergenic
1174277787 20:49416346-49416368 AAACAAAACACACTTAGGTGTGG + Intronic
1179000240 21:37451001-37451023 AGCCAAGACCTCCTTGGGTAAGG - Intronic
949402638 3:3682052-3682074 AAGAAGGACACCCTTAGGTTGGG - Intergenic
959168078 3:102806010-102806032 AACAAAGACAACCTTAGGGAAGG + Intergenic
961718444 3:128875340-128875362 AAACAAGGCACCCCTAGGAAGGG + Intergenic
962491894 3:135902600-135902622 GAACAGGACACCCTGAGGTATGG + Intergenic
962491987 3:135903367-135903389 GAACAGGACACCCTAAGGTATGG - Intergenic
970071474 4:12164460-12164482 ATCCAAAACTCCCTTGGGTAGGG + Intergenic
975885240 4:78957195-78957217 AAACAAGCCACCCCTTGGTAAGG - Intergenic
979647073 4:123082202-123082224 AACCAAGATGACCTTGGGTATGG - Intronic
980798526 4:137716787-137716809 AAACAAGGGAGCCTTAGGTAAGG + Intergenic
984855648 4:184193867-184193889 AATGAAAACACCCTTAGGTTAGG - Intronic
984942087 4:184941804-184941826 TACCAGGACACCCGCAGGTAGGG + Intergenic
992055260 5:72982694-72982716 AACCTAGACAACATTGGGTATGG - Intronic
996701606 5:126455802-126455824 AAGCATGACACCCTTGTGTATGG - Intronic
1008045265 6:46845239-46845261 CACCAAGACTCCTTTAGGAAAGG - Intergenic
1012032614 6:94091599-94091621 AACCAAGAAAAAATTAGGTATGG + Intergenic
1019438704 7:1035882-1035904 AACCAAGATGCCCTTCAGTAGGG + Intronic
1020892247 7:13892857-13892879 AACCAAGATGTCCTTAGGTCTGG - Exonic
1021078956 7:16340172-16340194 AACCAAGATGACCTTAGGTATGG + Intronic
1021506443 7:21390613-21390635 AACCTAGATATCCTTGGGTATGG - Intergenic
1021930188 7:25573012-25573034 CACCAAGACACCCTTCATTAGGG + Intergenic
1022916566 7:34961564-34961586 AACCTAGATGACCTTAGGTATGG + Intronic
1026434784 7:70386267-70386289 AACCAAGACGCTTTTTGGTATGG + Intronic
1035415100 7:158676941-158676963 AACCTAGACATTCCTAGGTAAGG + Intronic
1038141170 8:24847099-24847121 AACCAAGAGAACTTTTGGTAGGG - Intergenic
1044789351 8:95831544-95831566 AACCTAGATAACCTTGGGTATGG + Intergenic
1047170131 8:122484659-122484681 AACCAAGACACCGTTAATAAGGG - Intergenic
1052799056 9:32950684-32950706 AACCGAGACAGCCTGAGATATGG + Intergenic
1053652299 9:40181499-40181521 CACCAAGACTCCTTTAGGAAAGG + Intergenic
1054532283 9:66194716-66194738 CACCAAGACTCCTTTAGGAAAGG - Intergenic
1055265487 9:74491498-74491520 AACCCAGACACCATAAGGTTAGG - Intergenic
1058404391 9:104655381-104655403 TATCAAGACACACTGAGGTAAGG + Intergenic
1187457896 X:19458911-19458933 AGCCAAGACATCCTTAGAGATGG + Intronic
1195587370 X:106580448-106580470 AATCAAGATAACCTTAGGTTTGG + Intergenic
1195931573 X:110082509-110082531 AACCAACATATCCTTAGGGATGG + Intronic
1199145654 X:144363005-144363027 AACCAAGACACTCTTTTCTATGG - Intergenic
1200746331 Y:6907399-6907421 AACCTAGACAACCTTGGGTTCGG - Intergenic
1200931046 Y:8697464-8697486 ACCCAAGAAACCCTAAGGTGAGG + Intergenic