ID: 1076991799

View in Genome Browser
Species Human (GRCh38)
Location 11:279549-279571
Sequence CGCGCGCGTCCGCCCTCTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076991799_1076991807 29 Left 1076991799 11:279549-279571 CCTCAAGAGGGCGGACGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1076991807 11:279601-279623 CTGCAGCGTGAGTTCTGCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 89
1076991799_1076991802 -2 Left 1076991799 11:279549-279571 CCTCAAGAGGGCGGACGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1076991802 11:279570-279592 CGACGTGGCGGCGCAGCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
1076991799_1076991804 6 Left 1076991799 11:279549-279571 CCTCAAGAGGGCGGACGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1076991804 11:279578-279600 CGGCGCAGCTCCAGGAGCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 198
1076991799_1076991806 28 Left 1076991799 11:279549-279571 CCTCAAGAGGGCGGACGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1076991806 11:279600-279622 GCTGCAGCGTGAGTTCTGCGCGG 0: 1
1: 0
2: 2
3: 15
4: 123
1076991799_1076991803 3 Left 1076991799 11:279549-279571 CCTCAAGAGGGCGGACGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1076991803 11:279575-279597 TGGCGGCGCAGCTCCAGGAGCGG 0: 1
1: 0
2: 0
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076991799 Original CRISPR CGCGCGCGTCCGCCCTCTTG AGG (reversed) Exonic
907906062 1:58784402-58784424 TGCGAGCGTCCGCCCGCTCGCGG - Intergenic
914928526 1:151909419-151909441 CGCGCGCCTCCGCACGCTGGGGG - Exonic
916091927 1:161314341-161314363 GGCGCGCCTCCGCCCTCGGGTGG + Exonic
1073051673 10:100671173-100671195 CGCACGCGGCCGCCCCCTGGTGG - Intergenic
1076991799 11:279549-279571 CGCGCGCGTCCGCCCTCTTGAGG - Exonic
1081047635 11:38296310-38296332 CCCACGCGTCCCCCCTCCTGTGG - Intergenic
1098879438 12:75902205-75902227 CGCGCCCGGCCGGGCTCTTGTGG - Intergenic
1110860365 13:80340355-80340377 CCCGCGCGCCCGCGCTCTAGGGG - Intronic
1121279098 14:92687061-92687083 CGCGCGGGGCTGCCCCCTTGTGG - Intronic
1138243464 16:55447405-55447427 CGCGCGCGTGCACGCTCATGGGG - Intronic
1143620980 17:8080110-8080132 GGCGCGCGCGCGCCCTCTGGCGG - Exonic
1143750367 17:9022667-9022689 CGGGCGGGTGCGCCTTCTTGGGG - Exonic
1148000760 17:44385728-44385750 CGCGCCCGTCCCCACTCCTGTGG - Intronic
1160895880 19:1401582-1401604 CGCGCGCGCGCGTCCTCTCGCGG - Intergenic
1161490347 19:4557800-4557822 CACACGCGCCCGCCCTCTGGTGG - Intronic
1165157568 19:33797287-33797309 CGCGCGCGCGCGCGCGCTTGTGG + Intronic
926325918 2:11785088-11785110 CTCGCGCGGGCGCCCTCTGGTGG + Intronic
934156442 2:89205321-89205343 TGCGCACGTGCCCCCTCTTGTGG + Intergenic
946329840 2:219002804-219002826 CGCGCGCGTTCCCCCTCGTCGGG + Intergenic
1183154742 22:36066301-36066323 CGTGCGCGCGCGCCCTCTAGAGG - Intergenic
949970053 3:9396950-9396972 CGGGCGCGGCCGGCCTCCTGCGG - Intergenic
953326139 3:42013797-42013819 CGCGCGCGGCCCCACTCTGGGGG - Intronic
990955214 5:61333044-61333066 CGCGCGCGCCCGCACCCCTGCGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1016823702 6:148368748-148368770 CGCGCGCGTGCGCGCGCATGTGG - Intronic
1017163874 6:151390611-151390633 CGCGCGCTTCCGGCCTCCTCGGG - Intronic
1029114908 7:98231887-98231909 AGCGCACGTCCACCCACTTGTGG + Exonic
1034976999 7:155454668-155454690 CGCCCGCGACCACCCGCTTGCGG - Intergenic
1037811466 8:22089379-22089401 CGCGCCCGCCCGCCCTCCTGCGG - Intronic
1043390106 8:79784038-79784060 CGCTCGCCTCCGCCCTGTGGGGG - Intergenic
1186466013 X:9785629-9785651 GGCGCGGGTCCGGCCTCTGGAGG - Intronic
1191184130 X:57592196-57592218 CGCCCGGGCCCGCCATCTTGGGG - Exonic
1191213258 X:57910251-57910273 CGCCCGGGCCCGCCATCTTGGGG + Exonic
1200077189 X:153556993-153557015 AGCCCACGTCCGCCTTCTTGAGG - Exonic