ID: 1076991800

View in Genome Browser
Species Human (GRCh38)
Location 11:279555-279577
Sequence GAGGGCGGACGCGCGCGACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076991789_1076991800 15 Left 1076991789 11:279517-279539 CCGGAGCCTGCCCTGGAGGTGGC 0: 1
1: 0
2: 3
3: 45
4: 513
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991796_1076991800 -8 Left 1076991796 11:279540-279562 CCGCAAGACCCTCAAGAGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991790_1076991800 9 Left 1076991790 11:279523-279545 CCTGCCCTGGAGGTGGCCCGCAA 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991787_1076991800 16 Left 1076991787 11:279516-279538 CCCGGAGCCTGCCCTGGAGGTGG 0: 1
1: 0
2: 4
3: 59
4: 509
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991791_1076991800 5 Left 1076991791 11:279527-279549 CCCTGGAGGTGGCCCGCAAGACC 0: 1
1: 0
2: 0
3: 19
4: 166
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991783_1076991800 29 Left 1076991783 11:279503-279525 CCCAGTTCTACGGCCCGGAGCCT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991795_1076991800 -7 Left 1076991795 11:279539-279561 CCCGCAAGACCCTCAAGAGGGCG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991792_1076991800 4 Left 1076991792 11:279528-279550 CCTGGAGGTGGCCCGCAAGACCC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86
1076991784_1076991800 28 Left 1076991784 11:279504-279526 CCAGTTCTACGGCCCGGAGCCTG 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076991800 Original CRISPR GAGGGCGGACGCGCGCGACG TGG Exonic
901489449 1:9589164-9589186 GGGGGCGGCGGCGCGCGCCGGGG - Intronic
904181379 1:28668923-28668945 GAGGGCGGGCGGGCGCGCAGGGG + Intronic
905449376 1:38046913-38046935 GCGGGCGGGCGCGCGGGGCGGGG - Intergenic
905685058 1:39901930-39901952 GAGGGAGGGCGCGCGCGCGGGGG - Exonic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
918487515 1:185045410-185045432 AGGGGCGGAGGCGCGGGACGAGG - Exonic
1065204543 10:23344322-23344344 GAGGGAGCACGCGCGGGAGGAGG + Intronic
1066022533 10:31318697-31318719 GGGGGCGGACACGCGAGGCGTGG + Intronic
1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG + Exonic
1077051533 11:568920-568942 GGGGGCGGGCCCGCGGGACGCGG - Intergenic
1078210230 11:9264819-9264841 CAGGGCGGGCGCGGGCGAAGGGG - Intronic
1083683096 11:64360188-64360210 GAAGGCGGGCGGGCACGACGCGG + Exonic
1084086352 11:66857047-66857069 GCCGGCGGGCGCGCGCGCCGCGG - Intronic
1085011244 11:73142710-73142732 GAGCGGAGACGCGCGCGCCGGGG - Intergenic
1090326109 11:125887743-125887765 GAGAGCGGACTTCCGCGACGCGG + Exonic
1091286978 11:134412906-134412928 GTGGGCGGACGGGCGCGGGGAGG + Intergenic
1092045941 12:5431977-5431999 GGGCGCGGGCGCGCGCGGCGCGG + Intergenic
1092743133 12:11649454-11649476 GAGGGCGGGCGCCCGCACCGGGG + Intergenic
1096072472 12:48782906-48782928 GAGGGCGGGCGGGTGCGGCGTGG + Exonic
1096680406 12:53252046-53252068 GAGGGCGGGCGGGCGGGGCGGGG + Intronic
1104865310 12:131950043-131950065 GAGGGCGGAGGCGCGGGACGGGG + Intronic
1106776693 13:33016365-33016387 GTGGGCGGGCGGGCGCGGCGGGG + Intergenic
1108396608 13:49996853-49996875 GCAGGCGGAGGCGGGCGACGGGG + Intronic
1118206527 14:63728150-63728172 CAGGGCGGACCCGCGCGGCCCGG - Intergenic
1118971486 14:70641867-70641889 GAGGGCGGGAGCGGGCGGCGCGG + Exonic
1119364905 14:74083850-74083872 GAGGGGGGACGCGAGGGGCGAGG - Intronic
1122779126 14:104136277-104136299 GAGCGCGGGGGCGCGCGGCGCGG + Intergenic
1128582695 15:68820208-68820230 GAGGGGGGAGGCGCGGGAGGGGG + Intronic
1130648442 15:85748475-85748497 GAGGATGGACGAGAGCGACGGGG - Intronic
1131367652 15:91853674-91853696 GAGGGCGGAGGCGGGGGAGGAGG + Exonic
1133020036 16:2963310-2963332 GAGGGCGGAGGCGGGGGCCGGGG - Intergenic
1133220053 16:4316006-4316028 GAGGGCGGGCGGGCGGGAGGAGG - Intronic
1136419599 16:30123358-30123380 AAGGGCGGGCGCGCGCGGGGCGG - Intronic
1140927811 16:79600087-79600109 GAGGGCGGGCGCGGGGGGCGCGG - Exonic
1145925621 17:28644841-28644863 GAGGGAGGGGGCGCGCGGCGAGG - Intronic
1147994562 17:44353801-44353823 GGGGGCGGAGGTGGGCGACGAGG - Exonic
1150643464 17:66964613-66964635 CAGGGCGGAGGCGCGGGCCGAGG + Intergenic
1151797095 17:76353631-76353653 CGGGGCGGGCGCGCGGGACGCGG + Exonic
1157222419 18:45837556-45837578 GAGCGCGGAGGCAGGCGACGCGG + Exonic
1157529506 18:48409426-48409448 GAGGGCGGAGGCGCGGCGCGGGG - Intronic
1158436183 18:57436644-57436666 GAGGGTGGCCGCTCGCGACTGGG - Exonic
1160769123 19:822371-822393 GCGGGCGGAGGCGCGGGGCGGGG - Intergenic
1161101836 19:2425332-2425354 GCGGGCGGGCGAGCGAGACGGGG - Intronic
1161210411 19:3062566-3062588 GGGGGGGGACGCGCGCGCCCGGG + Intronic
1161582915 19:5090620-5090642 GGGGGCGCACGCGCGCAGCGGGG - Intronic
1168536096 19:57172065-57172087 GGGGGCGGGGGCGCGCGAGGGGG + Intergenic
926581432 2:14634959-14634981 GGCGGCGGACGCGCGTGGCGGGG - Exonic
928606031 2:32946403-32946425 GAGGGCGCCCGCGTGGGACGGGG - Intergenic
931035718 2:58240997-58241019 GAGCGAGGAGGCGCGCGGCGTGG - Intronic
931291963 2:60881441-60881463 GGGGGCGGTCGCGCGCGCGGCGG + Intergenic
932699556 2:73984172-73984194 GAGGGGGAACGGGCGCGTCGCGG - Intergenic
938258355 2:129877772-129877794 GGGGGCGGGCGCGCGTGTCGGGG + Intergenic
938258369 2:129877811-129877833 GGGGGCGGGCGCGCGTGTCGGGG + Intergenic
939432549 2:142130238-142130260 GAGGGCGGACACGCTTAACGCGG + Intronic
948213851 2:236214589-236214611 GGAGGCGGACGCGCGCGACGAGG - Exonic
948916181 2:241035981-241036003 GGGGGCGGAGGCGCGTCACGGGG + Intronic
949014590 2:241702213-241702235 GGGCGCGGCCGGGCGCGACGGGG + Intronic
1170578538 20:17681737-17681759 GGCGGCAGACGGGCGCGACGTGG - Intronic
1173516236 20:43667247-43667269 GCGGGCGGGCGAGCGCGGCGCGG + Exonic
1173589080 20:44210430-44210452 GACGGCGGAGGAGCGAGACGGGG + Intronic
1173807465 20:45935087-45935109 GGGGGCGGGAGCGCGCGGCGGGG + Intronic
1176069070 20:63216604-63216626 AAGGGCCGAGGCGCGCGACCTGG - Intergenic
950345283 3:12287775-12287797 GGGGGCGGCGGCGCGCGACTGGG - Intronic
952867069 3:37861661-37861683 GGGGGCGGCCGCGCGCGCGGGGG - Intergenic
955060246 3:55487212-55487234 GGGCGCGGACGCGCGCGAGCCGG + Exonic
966849427 3:184155549-184155571 GACGGCGGCGGCGCGCGGCGCGG - Exonic
967849414 3:194070959-194070981 GAAGGCGGCCGCGCGCAACGGGG + Intergenic
968081779 3:195851387-195851409 GAGGGCGGACGCACGAGTCACGG - Intergenic
968230576 3:197002858-197002880 GAGGCCGGACCGGGGCGACGGGG - Exonic
968512579 4:1002125-1002147 GAGGGCGGACGTGACCTACGCGG + Exonic
968514791 4:1011549-1011571 GAGGGCTGACGCGCGCGGATTGG + Intronic
969344757 4:6563707-6563729 GGGGGCGGGGGCGCGCGGCGAGG + Intergenic
985111923 4:186555276-186555298 CAGGGCGGACGCCAGCCACGAGG + Exonic
987373945 5:17217539-17217561 GCGGGCGGACGCGCGGGGGGAGG + Exonic
989287743 5:39721708-39721730 GAGGGCGGGCGGGCGCTGCGAGG - Intergenic
1006787524 6:36678608-36678630 GAGGGCGGTCCCGGGCGGCGCGG + Intronic
1016923381 6:149317616-149317638 GAGGGCAGGCGAGCGCGAGGGGG + Intronic
1017877697 6:158537373-158537395 GGGGGCGGATGGGCGCGGCGGGG + Intronic
1019344056 7:521045-521067 GAGGGAGGGCGACCGCGACGGGG - Intergenic
1031011233 7:116526490-116526512 GAGGGCGGACGGCCAGGACGGGG - Intronic
1034435386 7:151060609-151060631 GAGTGTGGAGGAGCGCGACGAGG + Intronic
1035404276 7:158587869-158587891 GAGGGCGGACGCGCGTCCGGGGG - Intergenic
1036910843 8:12755614-12755636 GAGCGCGGCCGCGGGCGGCGTGG - Intronic
1040055916 8:43056608-43056630 GGGGCCGGAAGCGCGCGCCGCGG - Intronic
1057596096 9:96417577-96417599 GCGGGCGGGCGGGCGGGACGTGG - Intronic
1058058551 9:100473242-100473264 GCGGGCGGGCGCGCGCGCGGCGG - Exonic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1061108786 9:128552513-128552535 GCGGGCGGGCGCGAGCGCCGGGG - Intergenic
1189137107 X:38561485-38561507 GCGGGCGGGCGCGCGGGAGGGGG - Exonic
1200229434 X:154436837-154436859 GTGGGCGGGCGCGCGCGGGGCGG + Intergenic