ID: 1076991926

View in Genome Browser
Species Human (GRCh38)
Location 11:279959-279981
Sequence CGTGGGCTGTGGTCCCGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076991913_1076991926 12 Left 1076991913 11:279924-279946 CCCGGGGAGGACCGGGGTGGGAG 0: 1
1: 1
2: 2
3: 41
4: 461
Right 1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 71
1076991914_1076991926 11 Left 1076991914 11:279925-279947 CCGGGGAGGACCGGGGTGGGAGG 0: 1
1: 0
2: 7
3: 55
4: 592
Right 1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 71
1076991905_1076991926 26 Left 1076991905 11:279910-279932 CCCACTTGGAGGGTCCCGGGGAG 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 71
1076991906_1076991926 25 Left 1076991906 11:279911-279933 CCACTTGGAGGGTCCCGGGGAGG 0: 1
1: 0
2: 3
3: 18
4: 239
Right 1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 71
1076991904_1076991926 27 Left 1076991904 11:279909-279931 CCCCACTTGGAGGGTCCCGGGGA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 71
1076991918_1076991926 1 Left 1076991918 11:279935-279957 CCGGGGTGGGAGGGCCGCCAGGG 0: 1
1: 0
2: 1
3: 42
4: 383
Right 1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076991926 Original CRISPR CGTGGGCTGTGGTCCCGTAG AGG Intronic
900138411 1:1128589-1128611 CCTGGGCTGTGGAGCAGTAGTGG + Intergenic
905859710 1:41342112-41342134 CGTGGGCGGTGGGCCCGTGGTGG + Intergenic
910324554 1:85990581-85990603 CCTGGGCTGTGGACCTGTACTGG - Intronic
917980717 1:180267267-180267289 CGTGGGCAGTGGCCCTGCAGTGG - Intronic
922714279 1:227858781-227858803 GGTGAGCTGTGGACCTGTAGAGG - Intergenic
1070129481 10:73646958-73646980 AGTGGGCTGGGGTGCCGGAGTGG + Exonic
1070806782 10:79275394-79275416 CAGGGGCTGTGGTCCCCAAGAGG - Intronic
1070812913 10:79307204-79307226 CGTGGTCTGTGGTACCCTAGGGG - Intronic
1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG + Intronic
1085553362 11:77396060-77396082 CGTGGGCTGTGGGCCTGAAATGG - Intronic
1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG + Intronic
1088845527 11:113662981-113663003 CATGGCCTGTGGACCCCTAGTGG - Intergenic
1088903696 11:114138001-114138023 CGTGGGCTGTGGGGCCCTTGGGG + Intronic
1096193671 12:49635397-49635419 TCTGGGCTGTGGTCCCTGAGAGG + Exonic
1101564898 12:105895865-105895887 CAGGGGCTGTGATCCAGTAGGGG - Intergenic
1101721423 12:107353636-107353658 CCTGGGCTGTGGACCAGTAGGGG + Intronic
1103600311 12:122050573-122050595 CGGGGGCTGTGGTCACATACAGG + Intronic
1103896511 12:124277146-124277168 CCTGGGTGGTGGTCACGTAGGGG + Intronic
1104707290 12:130956554-130956576 CTTGGGCTGGGCTCCAGTAGGGG + Intronic
1108354953 13:49621724-49621746 CGTGGGCAGTGGTTGCATAGGGG - Intergenic
1118822684 14:69355389-69355411 GGTGGGCTGTGCTCCCTGAGAGG - Exonic
1122893660 14:104744677-104744699 CCTGGGCTGTGGACCAGTACTGG - Intronic
1123937024 15:25198973-25198995 TGTGCCCTGTGGTCCCGGAGTGG + Intergenic
1128673241 15:69590273-69590295 TGTGGGCTGAGGTCCCTCAGTGG - Intergenic
1128876672 15:71207557-71207579 CCTGGGCTGTGGACCAGTACTGG + Intronic
1133760723 16:8796508-8796530 CATGGGCTGTGGTGCTGCAGTGG - Exonic
1137072268 16:35913944-35913966 TGTGGGCAGTGGTCTCGTTGTGG - Intergenic
1141841132 16:86574816-86574838 CGTGGGCTGTGGTCCCTGTGCGG + Intergenic
1144874241 17:18388896-18388918 TGTGGGCTGTGGCTCCATAGCGG - Exonic
1145157987 17:20555522-20555544 TGTGGGCTGTGGCTCCATAGCGG + Intergenic
1145937002 17:28720198-28720220 CGTGGGCTGAGTTCCGGTAGAGG + Intronic
1148184535 17:45632244-45632266 GGTGAGCAGTGGTCCCATAGTGG + Intergenic
1148820463 17:50356804-50356826 CTTGGGGTGTGGTGCCCTAGGGG + Intronic
1151577601 17:74960508-74960530 CGTGGGCTCTGCTCCCTGAGGGG - Intronic
1152458579 17:80429843-80429865 CCTGGGCTGTGGTCCTGTGGGGG - Intronic
1155910310 18:31498106-31498128 CGAGGGCTGTCTTCCCGTGGCGG - Exonic
1161266462 19:3366803-3366825 CGAGGGCTGGGGTCCGGTGGGGG + Intronic
1163217295 19:15890263-15890285 CTTGGGCTGTGGACCCAAAGTGG - Intronic
1164078270 19:21840496-21840518 CGTGGACTGTGTCCCCTTAGTGG + Intronic
1166313603 19:41976394-41976416 GGTGGGCTGCGCTCCCGCAGAGG - Exonic
928431175 2:31219468-31219490 AGTGGGCTGTGGACCAGAAGTGG + Intronic
929813967 2:45216180-45216202 CCTGGGCTGTGGACCAGTACTGG - Intergenic
934588947 2:95529249-95529271 CATGGGTTGTGGTGCCGTAGTGG - Intergenic
945038169 2:205721970-205721992 CGTTGGCTGTGGTACAATAGGGG + Intronic
947214410 2:227736825-227736847 CGTGTGATGTGGTGCGGTAGCGG + Intergenic
1169206133 20:3741250-3741272 GGTGGGCTGTGGTCCACAAGAGG - Intronic
1173192279 20:40885886-40885908 CTTGGGCTGTGGTGCCAAAGTGG - Intergenic
1176098183 20:63353620-63353642 AGGGGGCTGTGGTCCTGGAGGGG + Intronic
1176098247 20:63353802-63353824 AGGGGGCTGTGGTCCTGGAGGGG + Intronic
1181278699 22:21703450-21703472 CGTGGGCTGCGGCCCTGCAGAGG - Exonic
1184759724 22:46537538-46537560 CGGGGGCTGAGTTCCCGGAGCGG + Intergenic
954683004 3:52355934-52355956 AGTGGGCTGTGGGCCCCTCGAGG + Intronic
957384599 3:79479490-79479512 CTTGGGCTGTGGACCAGTACAGG - Intronic
968962163 4:3751153-3751175 AGTGGCCTGTGGTCCAGGAGTGG + Intergenic
969150957 4:5167993-5168015 CGTGGGCTGTGAGCCCCTTGAGG + Intronic
969340240 4:6535780-6535802 AGTGGGCTGTGGGCCTGTATGGG - Intronic
969682099 4:8649065-8649087 CGTGGGCTGTGGTCAGGTTGAGG - Intergenic
986706264 5:10457112-10457134 CGTGTGCAGTGGTCCTGGAGCGG + Intronic
989469186 5:41795317-41795339 CCTGGGCTGTGGACCAGTACCGG - Intronic
991625537 5:68596950-68596972 CCTGGGCTGTGGACCTGTACTGG - Intergenic
994112282 5:96020383-96020405 CGGGGGTTGTGGACCCCTAGAGG - Intergenic
998584061 5:143407178-143407200 AGTGGGCTGTGTTCCAGGAGTGG - Intronic
1001538101 5:172513880-172513902 CCTGGGCTGTGGACCAGTACTGG + Intergenic
1017235154 6:152111153-152111175 TGTGGGCTGTGGTCCCTTCCTGG - Intronic
1021360439 7:19706435-19706457 GGAGGGCTGTGGTCCCCTGGTGG + Intronic
1022484683 7:30769388-30769410 CCTGGGCTGTGGACCGGTATGGG - Intronic
1024780841 7:52846504-52846526 CCTGGGCTGTGGACCAGTACTGG - Intergenic
1028856246 7:95596839-95596861 CGTGGGCTGGGGTCCCGCCCAGG + Intergenic
1029206077 7:98870046-98870068 CGTGGGCCGGGGTCGCGCAGCGG - Intronic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1034444178 7:151103974-151103996 CTAAGGCTGTGGTCCCGTGGAGG - Intronic
1034996135 7:155578263-155578285 TGTGTGCTGTGGGCCCGCAGCGG - Intergenic
1035747561 8:1973530-1973552 CGTGGGCCGCGGTCCTGGAGGGG + Intergenic
1036707852 8:11058685-11058707 CGTGGGCTGGGGTCAAGTCGAGG + Intronic
1039618824 8:38978178-38978200 CATGGGCTGTGGACCAGTACAGG + Intronic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1061963566 9:134000297-134000319 CGTGAGCTGTGGTCTGGCAGGGG - Intergenic
1190691444 X:52916388-52916410 CCTGGGCTGTGGCCAGGTAGTGG - Intergenic
1190694539 X:52939404-52939426 CCTGGGCTGTGGCCAGGTAGTGG + Intronic
1195379041 X:104254252-104254274 TGGGGGCTGTGGTCCCTCAGCGG + Exonic