ID: 1076991993

View in Genome Browser
Species Human (GRCh38)
Location 11:280244-280266
Sequence GCCGGGGCGCGCGCGGCGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 437}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076991984_1076991993 12 Left 1076991984 11:280209-280231 CCGGAGGAGGCGATGGGGCCCGC 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437
1076991975_1076991993 27 Left 1076991975 11:280194-280216 CCCGAGAGCGCCGCCCCGGAGGA 0: 1
1: 0
2: 0
3: 60
4: 118
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437
1076991989_1076991993 -7 Left 1076991989 11:280228-280250 CCGCGGAAGAGCCTGAGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437
1076991983_1076991993 13 Left 1076991983 11:280208-280230 CCCGGAGGAGGCGATGGGGCCCG 0: 1
1: 0
2: 4
3: 25
4: 242
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437
1076991987_1076991993 -6 Left 1076991987 11:280227-280249 CCCGCGGAAGAGCCTGAGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437
1076991976_1076991993 26 Left 1076991976 11:280195-280217 CCGAGAGCGCCGCCCCGGAGGAG 0: 1
1: 0
2: 1
3: 9
4: 101
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437
1076991982_1076991993 14 Left 1076991982 11:280207-280229 CCCCGGAGGAGGCGATGGGGCCC 0: 1
1: 0
2: 0
3: 20
4: 186
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437
1076991980_1076991993 17 Left 1076991980 11:280204-280226 CCGCCCCGGAGGAGGCGATGGGG 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG 0: 1
1: 0
2: 5
3: 47
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076991993 Original CRISPR GCCGGGGCGCGCGCGGCGCT CGG Exonic