ID: 1076992189

View in Genome Browser
Species Human (GRCh38)
Location 11:281259-281281
Sequence CTGTCCTACCTGCTGGAGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076992181_1076992189 17 Left 1076992181 11:281219-281241 CCAGTTCATCGACCAGAGCTTCC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG 0: 1
1: 0
2: 0
3: 26
4: 313
1076992180_1076992189 21 Left 1076992180 11:281215-281237 CCTACCAGTTCATCGACCAGAGC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG 0: 1
1: 0
2: 0
3: 26
4: 313
1076992183_1076992189 5 Left 1076992183 11:281231-281253 CCAGAGCTTCCAGGAGTTCCTCG 0: 1
1: 0
2: 2
3: 21
4: 234
Right 1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG 0: 1
1: 0
2: 0
3: 26
4: 313
1076992185_1076992189 -4 Left 1076992185 11:281240-281262 CCAGGAGTTCCTCGCGGCACTGT 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG 0: 1
1: 0
2: 0
3: 26
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076992189 Original CRISPR CTGTCCTACCTGCTGGAGGA CGG Exonic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900587863 1:3442081-3442103 CTGCCATCCCTGCTGGTGGAAGG + Intergenic
901084475 1:6602252-6602274 CTGCGCTACCTGCGGGACGACGG - Exonic
901089770 1:6633465-6633487 CTGTCCAGGCTGATGGAGGAGGG - Exonic
901786176 1:11626286-11626308 CTGTCCTGCAGGCTGGAGGTGGG - Intergenic
901870001 1:12132947-12132969 CTGTCCTCCCAGCTGGAAAATGG - Intronic
902289931 1:15429116-15429138 CGGTGCGGCCTGCTGGAGGAGGG - Exonic
904846921 1:33426796-33426818 CTGTACTACCTCCTGAAGGTAGG - Intronic
905560301 1:38921257-38921279 CTGTACTTCCAGCTGAAGGAAGG + Intronic
906142265 1:43540764-43540786 CTGGCCAACTGGCTGGAGGAGGG + Intronic
908452474 1:64269616-64269638 CTCTCCTACCTGAGGGAGGGAGG + Intergenic
908579945 1:65504259-65504281 ATGTTCTACCTCCTTGAGGATGG - Intronic
911621275 1:100068530-100068552 CTCTCCTACCTACCGGAGGCAGG + Exonic
912480290 1:109977835-109977857 CTGTCCTCACTGCTGCAGAATGG + Intergenic
913159117 1:116129337-116129359 CTGTGCAGCCTGCTGGAGTAGGG + Intronic
915369639 1:155337721-155337743 GTGACCTACTTGCTGGAGGAAGG - Exonic
920067146 1:203277020-203277042 ATGTCCTACCTGCTCTAGGCTGG - Intergenic
920250385 1:204618899-204618921 CTGCCCAACCTGCAGGAGGTAGG - Exonic
920400371 1:205672339-205672361 CAGACCTGCCTGCTGGAGGAAGG + Intronic
922572467 1:226642186-226642208 CTTTCCTGCCTGGTGGATGAAGG + Intronic
922749824 1:228065101-228065123 CTCTCCCACCCACTGGAGGATGG - Intergenic
923085663 1:230701991-230702013 CTGTCCTACCTACTTGTGTAAGG - Intergenic
923215325 1:231843530-231843552 CTGGCCTCCCTGCAGGGGGATGG - Intronic
924259191 1:242212215-242212237 TTTTCCTATCTACTGGAGGAGGG - Intronic
1067536206 10:47112095-47112117 CTGTGCTACCTGCTGCGGCATGG + Intergenic
1067722221 10:48736787-48736809 CTGCCTTACCTGGTTGAGGAAGG + Intronic
1069618398 10:69820800-69820822 CCGCTCCACCTGCTGGAGGAAGG - Intronic
1069719536 10:70540810-70540832 ATGTCCTGCCTGATGGAGGGTGG + Intronic
1070911123 10:80119289-80119311 CAGTCCCACCTGCTGGTGTAGGG - Intergenic
1071507668 10:86242470-86242492 CTGAGCTGCCTGCTGGTGGAGGG + Intronic
1071602475 10:86965064-86965086 CTGACCTCCCTGCAGGAGCACGG + Intronic
1073542741 10:104326357-104326379 CTGTCCTTCCTGGGAGAGGATGG - Intronic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1076004013 10:126933541-126933563 CTGTCCTGCCTGCTGGCCTAGGG + Intronic
1076456842 10:130606006-130606028 CTCTCCTTCCTGCCTGAGGAAGG - Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077488187 11:2848591-2848613 CTGTCCCTCCTGCTGGAAGCTGG - Exonic
1078572760 11:12473744-12473766 GTGTCCGAGCTGCAGGAGGAGGG + Exonic
1079073990 11:17372126-17372148 CCGTCTTACCAGCTGCAGGATGG + Exonic
1079087585 11:17457849-17457871 CTGTGCCAACTGCTGCAGGATGG + Intronic
1080425555 11:32150879-32150901 CTTTCCTCCCTGTCGGAGGATGG - Intergenic
1081773134 11:45661938-45661960 TTGTCCTGCCTGCTGGGGCAGGG - Intronic
1082987978 11:59184262-59184284 CAGTCCTAGTTTCTGGAGGACGG - Intronic
1084358988 11:68657415-68657437 GTGGTCTGCCTGCTGGAGGATGG + Intergenic
1084549579 11:69833153-69833175 CTGTCCCAGCTGCTGGTGCACGG + Intergenic
1085172645 11:74462248-74462270 CTGACCCAGCTGCTGCAGGAAGG - Intronic
1085441564 11:76568604-76568626 ATGCCCCACCTTCTGGAGGAGGG + Intergenic
1087282418 11:96226423-96226445 CTGTCCTTCATGCCTGAGGATGG - Intronic
1087916941 11:103822053-103822075 CTGTTCTATATGCTGGAGGTAGG + Intergenic
1088748052 11:112820979-112821001 CTGTCCTACACCCAGGAGGAAGG + Intergenic
1089545929 11:119225433-119225455 CTGTCCTACAGGCTGGAGTGTGG + Intronic
1089576994 11:119451901-119451923 CTGTCCTGCCCTCTGGGGGATGG + Intergenic
1089581788 11:119485938-119485960 CTGTCCTCGCTGCTGGTAGAGGG + Intergenic
1089709926 11:120307334-120307356 CTGGGCTCCCTGCTGGGGGAGGG + Intronic
1091590673 12:1841146-1841168 CTGTCCTTCCTGCCGTTGGAAGG - Intronic
1092403258 12:8195932-8195954 CTGTCCTACCTCCTGAAAGCTGG - Intergenic
1092405254 12:8217333-8217355 CTGTCCTACCTCATGAAGGTGGG + Intergenic
1093580540 12:20780617-20780639 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1093885386 12:24453683-24453705 CTTTCCTAGCTGCTGGATGTAGG - Intergenic
1097186911 12:57200949-57200971 GTGTCCTCCCTGCTGAGGGATGG + Intronic
1097333629 12:58358358-58358380 CTGTGCTAGGTGCTGGAGGGCGG + Intergenic
1097572736 12:61355120-61355142 CGGTCCTGCCTGCTGAACGAGGG - Intergenic
1101108139 12:101459950-101459972 CTGTCCCTCCTGTTGGTGGAGGG + Intergenic
1101772886 12:107767690-107767712 CTGCCCCATCCGCTGGAGGAAGG - Intergenic
1102184571 12:110937587-110937609 CAGTCCTTCCTGCTGGGGGCCGG + Intergenic
1103347687 12:120262279-120262301 CTGTTCCCCCTGCTAGAGGATGG + Intronic
1103355594 12:120317454-120317476 CTGTCCTTCCTGCTGGATTCTGG + Intergenic
1103924079 12:124414103-124414125 CTGTCCTACCTGGCGGATCAGGG + Intronic
1103949453 12:124543083-124543105 TTGCCCTAGCTGGTGGAGGAGGG - Intronic
1104003011 12:124872439-124872461 CTGTCCTACCTACCAGAGAAGGG + Intronic
1104345597 12:127993842-127993864 CTTTCCTCCCTGCTGCAGGGTGG + Intergenic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1105240133 13:18600648-18600670 CTGTCCACGCTGCTGGAGGCGGG + Intergenic
1110578604 13:77091549-77091571 CTGTCTTGCCTCCTGTAGGATGG + Intronic
1111845297 13:93500124-93500146 CTGTCCTATCTGCTCGTGGTGGG - Intronic
1113140695 13:107146018-107146040 CTGTCCTACCTGGCACAGGATGG + Intergenic
1113839483 13:113350683-113350705 CTGTCCTCCCTGCTGGGAAATGG + Intronic
1113986395 13:114319770-114319792 CTGTCCTGCCTGAAGGATGAAGG + Intronic
1116520435 14:45840125-45840147 CTGTCCTACTTGCTAAATGAAGG - Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120704932 14:87735966-87735988 TTGCCCTGCCAGCTGGAGGAGGG + Intergenic
1121246740 14:92466047-92466069 CTGTCCTACCTCCTGCAGGGCGG - Intronic
1122138010 14:99645693-99645715 CCGTCCTTCCTGCTTCAGGAGGG - Intronic
1122886582 14:104713052-104713074 CTGCCCATCCTGCCGGAGGAAGG - Intronic
1123154318 14:106209838-106209860 CTGTGCTCCCTGCAGGTGGAGGG - Intergenic
1123449023 15:20349031-20349053 CAGCCCTACATGCTGGGGGAGGG - Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1125734837 15:41917617-41917639 CAGTTGTACCTGCTGGAGAAAGG + Intronic
1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG + Exonic
1128108689 15:65062641-65062663 CTGTGCTACCTGCTGGAAATGGG + Intronic
1128471927 15:67961730-67961752 CTGTCTTCCATGCTGGGGGATGG + Intergenic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1129281405 15:74487980-74488002 CTGATCTACCTGCTGGAGCTGGG - Intergenic
1129452187 15:75657337-75657359 CTGTCCTGCCTCCTGGGAGAAGG + Exonic
1130772222 15:86936008-86936030 CTGCCTTGCCTGCTGGAGCAGGG - Intronic
1130823749 15:87522183-87522205 CTGGCCTGCCTGCTTGAGTAAGG - Intergenic
1132622848 16:875878-875900 GGGTCCCAGCTGCTGGAGGAGGG - Intronic
1132710104 16:1262702-1262724 GTGTCCTTCCTGGGGGAGGACGG + Intergenic
1132749916 16:1452750-1452772 ATGTCCTACCCGCTGCAGGTGGG - Exonic
1134212813 16:12292039-12292061 CTGTCAGATCTGCTGGTGGAGGG + Intronic
1135025448 16:18995883-18995905 CTGTCCTAGATCCAGGAGGAAGG - Intronic
1135207141 16:20493009-20493031 CTGTCCGCCCTGCTGCAGCAGGG + Intergenic
1135211744 16:20530623-20530645 CTGTCCGCCCTGCTGCAGCAGGG - Intergenic
1135380229 16:21989893-21989915 ATGACCTAGCTGCTGGAGGTGGG - Intronic
1135964632 16:27025505-27025527 TTCTCCTCCCTGCAGGAGGATGG - Intergenic
1136146960 16:28321498-28321520 CTGCCCTCCCTTCTGGAGGCTGG + Exonic
1137585600 16:49662397-49662419 TTGTCCTTCCTCTTGGAGGATGG - Intronic
1137709029 16:50553883-50553905 CTGTCTTTCCTCCTGGGGGATGG + Intronic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1139265395 16:65634065-65634087 CTGTCCTACCTACTTCAGGTAGG - Intergenic
1140905029 16:79402554-79402576 CTGGCCTACCTCCAGGAGCAGGG + Intergenic
1141154504 16:81587834-81587856 CTGTCCAGCCTCCTGGAGAAAGG + Intronic
1141289338 16:82703362-82703384 TTGTTCTAGCTGCTGGAGCATGG + Intronic
1141655858 16:85416273-85416295 CTCGCCAGCCTGCTGGAGGAGGG + Intergenic
1142105009 16:88297942-88297964 CTGTGCTCCCAGCTTGAGGAAGG + Intergenic
1142118103 16:88370937-88370959 CCAGGCTACCTGCTGGAGGATGG + Intergenic
1142292178 16:89198247-89198269 CTGCCCTACTTCCTGGAGGCCGG - Exonic
1142559458 17:801286-801308 CTGCCCTGCCTTCCGGAGGAAGG + Intronic
1142872262 17:2828596-2828618 CAGTGCCACCTGCTGGCGGACGG - Intronic
1142899921 17:3005427-3005449 GTGTCCTACCTTCTGGAAAACGG - Exonic
1144248464 17:13392042-13392064 AAGTCCTACCTCCTGGAGGGAGG + Intergenic
1146590961 17:34127672-34127694 CTGCTCTTCCTGCTGCAGGACGG + Intronic
1147575318 17:41595598-41595620 CTGTCCAGTCTGATGGAGGAGGG + Intergenic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148031989 17:44628033-44628055 TTGTCCTCCCTGCTCCAGGACGG + Intergenic
1148392752 17:47284702-47284724 CTGTCCTGGCGTCTGGAGGAGGG - Intronic
1150957087 17:69870943-69870965 CTGTCCTTCCTACTGTAGGGAGG - Intergenic
1151170097 17:72238556-72238578 ATGTCCTCCTTGCTGAAGGAAGG + Intergenic
1151356624 17:73562456-73562478 CTGGCCTAACTTCTGGAGGGAGG - Intronic
1152339625 17:79716833-79716855 TAGCCCTACCTGCTGGGGGAGGG + Intergenic
1153592213 18:6685502-6685524 CCGTCTTTCCTGCTGGATGATGG + Intergenic
1155479374 18:26268738-26268760 CTGTCTTTCCTGCTGGATCATGG + Intronic
1157669625 18:49517376-49517398 CTTTGCTACCTGCTGGGGAAAGG - Intergenic
1157857522 18:51116173-51116195 CTGCCTTAGCTGCTCGAGGAAGG + Intergenic
1159954733 18:74511167-74511189 CTGTCCACCCTGGTGTAGGACGG - Intronic
1160398525 18:78590334-78590356 CTGTGCTCCCTACTGGAGGTAGG + Intergenic
1160947546 19:1650745-1650767 CTGTGCCATCTGCTGGGGGAGGG - Intronic
1162390140 19:10384809-10384831 TTGTCCTGCCTGCTGCGGGAGGG + Intergenic
1162577718 19:11508420-11508442 CTGTCATCCATGCTGGAGAATGG + Intronic
1162771023 19:12949365-12949387 CTGGCCCAGCTGCTGGAGCAGGG - Exonic
1163629159 19:18408278-18408300 TTGTCCTACCTGAGGGTGGAGGG - Intergenic
1163743578 19:19032043-19032065 CAGTTCTATCTGCTGGAGGAAGG + Intronic
1165067289 19:33236642-33236664 CTGAGCTATCTGCTGGAGGAGGG + Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166714986 19:44961279-44961301 CTGTCCCACCTGCTGGACCAGGG + Intronic
1167367352 19:49061804-49061826 CTGCTCTTCCTGCTGGAGGCTGG - Exonic
1167409621 19:49337246-49337268 CTCTCCTCCCTGCTGGGGGTGGG - Intronic
925306312 2:2849983-2850005 CTGCCCCAGCTGCTGGAGGGAGG - Intergenic
925702215 2:6650179-6650201 CTCACCTACCTGCTGCATGAAGG - Intergenic
925920251 2:8633240-8633262 CTGCCCCACCTGCCAGAGGAAGG + Intergenic
926374049 2:12209296-12209318 CTGCCCTATATTCTGGAGGAAGG + Intergenic
926787359 2:16531319-16531341 CTGTCCTGCCTGCTGGTGAAAGG + Intergenic
928126589 2:28620696-28620718 AGGGCCTTCCTGCTGGAGGAGGG + Intronic
930038565 2:47103263-47103285 CTCTCGTAGCTGCTCGAGGAAGG - Intronic
930466347 2:51755174-51755196 CTGTCCTATATGTTGTAGGATGG + Intergenic
932343298 2:70979823-70979845 ATCTACTACCTGCTGGAGAAAGG + Exonic
932856773 2:75241830-75241852 CTGTCCTCTGTGGTGGAGGAGGG - Intergenic
934758357 2:96839869-96839891 CTGACCTTCCTGCATGAGGAGGG - Intronic
935169822 2:100602318-100602340 CTGTCCTCCAGGCTGGAGGGCGG - Intergenic
935812811 2:106816871-106816893 TTCTCCTCCCTGCTGGGGGATGG - Intronic
936022111 2:109002640-109002662 CTCTCCCACCTGCTGGAGGGTGG - Intergenic
936901087 2:117482531-117482553 CTTTCATACCTGCTGGAGACTGG + Intergenic
937222374 2:120349203-120349225 CTGCCCTACGTCCTGGAGAAGGG + Exonic
937352443 2:121174866-121174888 CTGTCTCACGTGCTGAAGGAAGG - Intergenic
937461839 2:122095949-122095971 CTGCCTTACCTCCAGGAGGAAGG + Intergenic
937856933 2:126678911-126678933 CTGTCAAACCCGGTGGAGGAAGG + Intronic
937906846 2:127056638-127056660 CTGGCCTACCCACAGGAGGAAGG + Intronic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
941149364 2:161894758-161894780 CTGTTCTCCCTCCTGGAGAATGG + Exonic
947316691 2:228866484-228866506 CAGTCCTGCCAGCTGGAGGGGGG + Intronic
947648988 2:231768425-231768447 CTGTCGTACATGCTGGAGTGCGG + Intronic
947963307 2:234258142-234258164 ATGTCCCACTTGCTGGAGGAGGG + Intergenic
948592392 2:239059823-239059845 CTGTCCTGCAGGCTGGTGGATGG - Intronic
1169138202 20:3210358-3210380 CTTTCTTCCCTGCTGGGGGATGG + Intronic
1170809008 20:19659045-19659067 CTTTCGTCTCTGCTGGAGGACGG + Intronic
1173374279 20:42469602-42469624 CAATTCTACCTGCTGGAGGAAGG + Intronic
1173458347 20:43221936-43221958 GTGTCCTTCCTGCTGGATTATGG - Intergenic
1174089786 20:48037827-48037849 CTCTCCTACTTTCCGGAGGAGGG - Intergenic
1174126510 20:48310740-48310762 CTCTCCTACTTTCCGGAGGAGGG + Intergenic
1175060570 20:56238545-56238567 CTGACCTATCTGCTTCAGGAAGG + Intergenic
1175608749 20:60332723-60332745 CTGTCCCACACTCTGGAGGAAGG - Intergenic
1175762760 20:61572495-61572517 CTGCCCTCTCTCCTGGAGGAGGG + Intronic
1176312046 21:5156666-5156688 CTCTCTTACCTTCTGGAAGAGGG - Intergenic
1176967964 21:15232710-15232732 CTGTCCTACCCCATGGATGAAGG - Intergenic
1177411803 21:20739087-20739109 ATATCCTACCTCCTAGAGGATGG - Intergenic
1178556813 21:33599145-33599167 TTGTCCTAGATGCTGGAGGTAGG - Exonic
1179015684 21:37592829-37592851 CTGCCCTGGGTGCTGGAGGAGGG - Intergenic
1179489881 21:41734358-41734380 CTGTCCTTTCTCCTGGAGCAAGG + Intergenic
1179587658 21:42383815-42383837 TACCCCTACCTGCTGGAGGAGGG - Intronic
1179845002 21:44105364-44105386 CTCTCTTACCTTCTGGAAGAGGG + Exonic
1180881627 22:19208145-19208167 ATGGCCTACCTGCTGGATGTGGG + Exonic
1181628714 22:24138886-24138908 CTGCCCCACATCCTGGAGGAAGG - Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG + Exonic
1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG + Intergenic
1182093285 22:27610140-27610162 CTTTTCTGCCTGCTGGAGAAAGG - Intergenic
1182260458 22:29070393-29070415 CTGTCCTGCCTGCTGCGGGAAGG - Intergenic
1182661720 22:31929776-31929798 CTGGTCTACCAGCGGGAGGATGG - Intergenic
1183265570 22:36823202-36823224 CTGGCCTCCCAGCTGGTGGAGGG + Intergenic
1183469058 22:37996212-37996234 CCTTCCTGCCTGCTGGGGGAAGG - Intronic
1184190598 22:42892029-42892051 CTCTCCTTCCTCCTGCAGGATGG - Intronic
1184285576 22:43469207-43469229 CCGTCTTACCTGCTGCAGGGAGG + Intronic
1184484585 22:44768724-44768746 GTGTCCTTCCTGTTGCAGGAAGG + Intronic
950157048 3:10729490-10729512 CAGTCCTTCCTGCCTGAGGAAGG + Intergenic
951875334 3:27418531-27418553 CTGTCCTACCTCCAGGAGAGTGG - Exonic
953543026 3:43839587-43839609 CTGTCCTGACTGCTGCTGGAAGG + Intergenic
953716659 3:45321786-45321808 CTGTCCTGCCTCCTGGCGGGTGG - Intergenic
953929826 3:47000324-47000346 CTCTCCAATGTGCTGGAGGACGG + Exonic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955906094 3:63809255-63809277 CTATGCTACCTTCTGGAGGCTGG - Intergenic
955925086 3:63996470-63996492 ATTTCCTACCTGATGAAGGAGGG - Exonic
956823287 3:72973195-72973217 GTGTTCTACCAGCTGGGGGAGGG + Intronic
958903984 3:99921986-99922008 CTCTACTATCTTCTGGAGGAAGG - Intronic
960055021 3:113270953-113270975 CGGGCCCACCTGCTGGGGGATGG + Intronic
960369933 3:116822656-116822678 ATTGCCTACCTGCAGGAGGATGG - Intronic
961474828 3:127140150-127140172 CTGCCCTCCCGGCTAGAGGAGGG + Intergenic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963094400 3:141520375-141520397 GTGGTGTACCTGCTGGAGGAGGG + Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
963932735 3:151020986-151021008 CTGTCCTTGCTCCTGGTGGATGG - Intergenic
966539815 3:181076795-181076817 TTGTCCTCCCTGCTAGAGAAGGG + Intergenic
968191943 3:196674838-196674860 ATGTCCTACCTGCTGGGTGCTGG - Intronic
968540441 4:1165554-1165576 CTGCCCTCCCTCCTGGAGCATGG - Intergenic
969760860 4:9180638-9180660 CTGTCCTACCTCATGAAGGTGGG - Intergenic
969762810 4:9201928-9201950 CTGTCCTACCTCCTGAAAGCTGG + Intergenic
969907806 4:10413599-10413621 ATGTCCTTCCTGCTGGTGGGAGG - Intergenic
970038447 4:11768199-11768221 CTGTCCTAGCTGCACAAGGAAGG - Intergenic
972933851 4:44106974-44106996 CTCTCCCACCTGATGAAGGAAGG - Intergenic
975498201 4:75057503-75057525 CTGTCCCACCAGCTGGATAAAGG - Intergenic
976845655 4:89486734-89486756 CTGTGCTTCCTACTGGAGAAAGG - Intergenic
981914490 4:150018759-150018781 TTGTGCTTCCTGCAGGAGGAAGG + Intergenic
982455713 4:155607207-155607229 TGGTGCTACCTGCTGGAGAAAGG - Intergenic
983923484 4:173371378-173371400 CTGTGCTGCCTGCGGGAGGATGG + Exonic
984922500 4:184778140-184778162 CTGCCCTACCTACTGGACAAAGG + Intronic
984996745 4:185439338-185439360 ATGTCCTACAAGCTGGAGAAAGG + Intronic
986170408 5:5310233-5310255 GGGTCCTACGAGCTGGAGGATGG - Intronic
988814952 5:34825655-34825677 CTGGCCGTGCTGCTGGAGGAAGG + Intronic
990273879 5:54175006-54175028 CTGGACTATCTCCTGGAGGAGGG + Intronic
990595688 5:57310368-57310390 CTATCCTCCCTGCTGGTGGGTGG + Intergenic
990951261 5:61300654-61300676 CTTGCCTACCTGCAGCAGGAAGG + Intergenic
991183443 5:63781106-63781128 CTAGCTTACCTGCTGGAGAATGG - Intergenic
991593788 5:68281971-68281993 CTATCCTACCTGCTGCAGGTGGG - Intronic
992040917 5:72830780-72830802 TTGTCCTAAATCCTGGAGGAGGG - Intronic
994260472 5:97652712-97652734 ATGGCCTACCTGATGGTGGAGGG - Intergenic
998797139 5:145832606-145832628 CTGTCCTACCTGCTAGCTGTGGG + Intronic
998879479 5:146631909-146631931 CACTCTTACCTCCTGGAGGAAGG + Intronic
998993970 5:147850291-147850313 CTCTTCTACCTGCTGTAAGATGG + Intergenic
999128384 5:149264005-149264027 CTGTTCTACCTGATGGAAAAGGG + Intergenic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
1001582653 5:172809454-172809476 CTGTCCTATATCATGGAGGAAGG + Intergenic
1002080329 5:176733684-176733706 CTGTCCTCCCTGTTGGACGGTGG + Intergenic
1003358055 6:5393792-5393814 CTGTCCTCCTTGCGTGAGGATGG + Intronic
1003664944 6:8102242-8102264 CCATCCTACCTCCTGGAGGGAGG - Intronic
1004720798 6:18265976-18265998 CAGGCCTACCAGCTGCAGGAAGG - Intergenic
1005128380 6:22474340-22474362 TTGTAATACCTGCTGGAGTATGG + Intergenic
1005128388 6:22474397-22474419 TTGTAATACCTGCTGGAGTATGG + Intergenic
1005436015 6:25813086-25813108 GTGTTCTACCTGCTGGACCAGGG + Exonic
1006155550 6:32011155-32011177 GTCTCCTACCAGCTGGCGGACGG - Intergenic
1006161882 6:32044009-32044031 GTCTCCTACCAGCTGGCGGACGG - Exonic
1006996645 6:38267434-38267456 CTCCCCTACCTGTTGGATGAAGG - Intronic
1007262397 6:40572873-40572895 CTCCTCTACCTGCTGGGGGAAGG + Intronic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1007756818 6:44104820-44104842 CAGTGCTTCCTGCTGGAGGTTGG - Intergenic
1008518896 6:52344409-52344431 CTGTCCTATTTGCTTGAGGTGGG + Intergenic
1008744185 6:54648647-54648669 ATGTCCTACCTTCTTGATGAAGG - Intergenic
1009278616 6:61718654-61718676 CTGTACTTCCTCCTGTAGGATGG + Intronic
1011034407 6:82957710-82957732 CTGTGGGACCTGCTGGGGGAAGG + Intronic
1011353021 6:86444316-86444338 CTGTCCCACCTCCAGGAGGAAGG + Intergenic
1011353022 6:86444320-86444342 CTTTCCTTCCTCCTGGAGGTGGG - Intergenic
1013366896 6:109443658-109443680 GTGTCCTGGCGGCTGGAGGAGGG + Exonic
1013466982 6:110426494-110426516 CTGGCCTCCCTCCAGGAGGAGGG - Intronic
1015547239 6:134374073-134374095 GTTTCCAACCTGCTGGAGGTGGG - Intergenic
1015580599 6:134720421-134720443 CTCTGCTTCCTGCTGTAGGAAGG - Intergenic
1016184042 6:141178844-141178866 CTTCCATAGCTGCTGGAGGAAGG - Intergenic
1016271175 6:142292441-142292463 ATGTCCTACCTGGTGGAGAAGGG - Intergenic
1016840437 6:148519690-148519712 GTGTCCAGGCTGCTGGAGGATGG - Exonic
1017028015 6:150198005-150198027 CTGCCCTTCATGGTGGAGGAGGG + Intronic
1018186483 6:161269519-161269541 CAGTCCCAGCTGCTGGGGGAGGG + Intronic
1019294935 7:269063-269085 CCTTCCTGGCTGCTGGAGGACGG + Intergenic
1019712032 7:2522181-2522203 CTGACCCACATGCTGGGGGAAGG + Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021919706 7:25472491-25472513 CTTTCCTACATGGGGGAGGAGGG - Intergenic
1022471988 7:30687744-30687766 CTGTGCCACCTGCTGGAGGGAGG + Intronic
1023520002 7:41040324-41040346 CAGACCTACCTGATGAAGGAGGG + Intergenic
1027421932 7:78025197-78025219 CTGACTTCTCTGCTGGAGGAAGG + Intronic
1027453606 7:78360707-78360729 CTGTCCCTCCTGCTGGAAGAGGG - Intronic
1027854253 7:83488632-83488654 CTCTCCTAGCTTCTGGAAGAAGG - Intronic
1028437315 7:90819705-90819727 CTCTTCTTCCTACTGGAGGAAGG - Intronic
1029916848 7:104218941-104218963 CTCTCCTAGCTTCTGGTGGAGGG - Intergenic
1032326165 7:130930418-130930440 CTGTCAGTGCTGCTGGAGGAAGG - Intergenic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1034958198 7:155349019-155349041 CTGTCTGACCTGGTGGAGAATGG + Intergenic
1036270969 8:7302489-7302511 CTGTCCTACCTCATGAAGGTGGG - Intergenic
1036272902 8:7323664-7323686 CTGTCCTACCTCCTGAAAGCTGG + Intergenic
1036348448 8:7986684-7986706 CTGTCCTACCTCCTGAAAGCTGG - Intergenic
1036350380 8:8007855-8007877 CTGTCCTACCTCATGAAGGTGGG + Intergenic
1036845648 8:12168280-12168302 CTGTCCTACCTCATGAAGGTGGG + Intergenic
1036865090 8:12389468-12389490 CTGTCCTACCTCCTGAAAGCTGG - Intergenic
1036867016 8:12410599-12410621 CTGTCCTACCTCATGAAGGTGGG + Intergenic
1037490554 8:19393416-19393438 CTGTCCTATCTGTCGGAGGACGG + Exonic
1038638795 8:29307661-29307683 CTCTCATAGCTGCTCGAGGAAGG - Intergenic
1040454231 8:47579885-47579907 CTGTCCTCCCTCCTGGGAGATGG + Intronic
1040841556 8:51790652-51790674 CTGTCCTCCCTGATGGGCGAGGG + Intronic
1041773312 8:61496333-61496355 CTGTCCAAGGTGCTGGAGGGAGG + Intronic
1042086865 8:65119083-65119105 CTGTGCTACCTGTTGGCTGAAGG + Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1043491467 8:80753301-80753323 TCTTCCTTCCTGCTGGAGGAGGG + Intronic
1045991533 8:108314389-108314411 CTGCCCTACACCCTGGAGGAAGG + Intronic
1046474586 8:114725256-114725278 CTGGCCTACTTGAGGGAGGAGGG + Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047945174 8:129869826-129869848 CTGTACTTCCAGCTTGAGGAAGG - Intronic
1048114757 8:131509142-131509164 TTGTCCTACCATCAGGAGGAGGG - Intergenic
1048426588 8:134329156-134329178 CCGTGGTAGCTGCTGGAGGAGGG - Intergenic
1048842393 8:138577343-138577365 CTGTCCTCACTGCTGGATGGAGG + Intergenic
1049204901 8:141359156-141359178 CTCCCCCACCTGCTGGAGAAGGG + Intronic
1049410557 8:142472056-142472078 CTGCCCGACCTGCTGGAGTCGGG + Intronic
1049965341 9:774514-774536 CTGTCGTCCCAGCTGGAGTACGG + Intergenic
1052883733 9:33623404-33623426 CTGTCCACACTGCTGGAGGGTGG - Intergenic
1057711554 9:97450146-97450168 CTGTCTCTCCTGCTGGAGGTGGG + Intronic
1058866565 9:109166900-109166922 CTGCGCTACCTGTCGGAGGAGGG - Exonic
1061017276 9:127989179-127989201 CTGGCCTCCCAGCTGAAGGAGGG - Intergenic
1062128634 9:134880606-134880628 CTGTCATCCCTGCAGGGGGACGG - Intergenic
1062250210 9:135590043-135590065 CTGCCTCACCTGCTGGAGCAGGG - Intergenic
1062380820 9:136285741-136285763 CAGGCCTCTCTGCTGGAGGAAGG + Intronic
1185816867 X:3164239-3164261 ATGTCCTGGCTGCAGGAGGAAGG - Intergenic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1187744189 X:22390283-22390305 TTGTGCTACGTGCTGGAGGCTGG + Intergenic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1190286928 X:48967490-48967512 CTGTCTTACCTGCTCTAGGTAGG + Intronic
1192247284 X:69384221-69384243 CTGTCCTTCCTGCTGGTGAGGGG - Intergenic
1195629284 X:107037320-107037342 CTTTCCTCCCTTCTGGAGTATGG - Intergenic
1196919242 X:120569046-120569068 TTGTCCTACCTGCTTGATGGTGG - Intronic
1199315882 X:146377441-146377463 TTGACCTACCTGTTGGAGGATGG + Intergenic
1199648737 X:149934821-149934843 CTGTCCTCCGTGCAAGAGGAGGG - Intronic
1200280810 X:154775472-154775494 CTGTCCTATCTGCTGGGAGGAGG + Intronic
1201264515 Y:12193169-12193191 ATGTCCTGGCTGCAGGAGGAAGG + Intergenic
1202272057 Y:23082247-23082269 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1202293969 Y:23338435-23338457 CTCTCGTAGCTGCTCGAGGAAGG - Intergenic
1202425054 Y:24715991-24716013 CTCTCGTAGCTGCTCGAGGAAGG + Intergenic
1202445735 Y:24954094-24954116 CTCTCGTAGCTGCTCGAGGAAGG - Intergenic