ID: 1076997802

View in Genome Browser
Species Human (GRCh38)
Location 11:307412-307434
Sequence GTTGCAGTCCTGCTCCATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076997802_1076997806 -5 Left 1076997802 11:307412-307434 CCCGCATGGAGCAGGACTGCAAC No data
Right 1076997806 11:307430-307452 GCAACCCCAGCAAAGGACAAGGG No data
1076997802_1076997810 11 Left 1076997802 11:307412-307434 CCCGCATGGAGCAGGACTGCAAC No data
Right 1076997810 11:307446-307468 ACAAGGGATGTCAGCAGATGAGG No data
1076997802_1076997805 -6 Left 1076997802 11:307412-307434 CCCGCATGGAGCAGGACTGCAAC No data
Right 1076997805 11:307429-307451 TGCAACCCCAGCAAAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076997802 Original CRISPR GTTGCAGTCCTGCTCCATGC GGG (reversed) Intergenic
No off target data available for this crispr