ID: 1076999691

View in Genome Browser
Species Human (GRCh38)
Location 11:316343-316365
Sequence GTCCCCCGGCACCCCGCGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999691_1076999705 24 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data
1076999691_1076999703 20 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999703 11:316386-316408 TGGACAAGTTTGCCTCCCAGAGG No data
1076999691_1076999704 21 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999704 11:316387-316409 GGACAAGTTTGCCTCCCAGAGGG No data
1076999691_1076999696 -5 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG No data
1076999691_1076999698 0 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999698 11:316366-316388 CGGCCAGGCTGACCCCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999691 Original CRISPR GTCCCCCGGCACCCCGCGTA GGG (reversed) Intergenic
No off target data available for this crispr