ID: 1076999692

View in Genome Browser
Species Human (GRCh38)
Location 11:316344-316366
Sequence GGTCCCCCGGCACCCCGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999692_1076999705 23 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data
1076999692_1076999703 19 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999703 11:316386-316408 TGGACAAGTTTGCCTCCCAGAGG No data
1076999692_1076999704 20 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999704 11:316387-316409 GGACAAGTTTGCCTCCCAGAGGG No data
1076999692_1076999698 -1 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999698 11:316366-316388 CGGCCAGGCTGACCCCGGCGTGG No data
1076999692_1076999696 -6 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999692 Original CRISPR GGTCCCCCGGCACCCCGCGT AGG (reversed) Intergenic
No off target data available for this crispr