ID: 1076999695

View in Genome Browser
Species Human (GRCh38)
Location 11:316357-316379
Sequence GGTCAGCCTGGCCGGTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999695_1076999711 28 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999711 11:316408-316430 GGCGGAGACTGAGAGGCGAAGGG No data
1076999695_1076999705 10 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data
1076999695_1076999710 27 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999710 11:316407-316429 GGGCGGAGACTGAGAGGCGAAGG No data
1076999695_1076999708 21 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG No data
1076999695_1076999703 6 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999703 11:316386-316408 TGGACAAGTTTGCCTCCCAGAGG No data
1076999695_1076999704 7 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999704 11:316387-316409 GGACAAGTTTGCCTCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999695 Original CRISPR GGTCAGCCTGGCCGGTCCCC CGG (reversed) Intergenic
No off target data available for this crispr