ID: 1076999696

View in Genome Browser
Species Human (GRCh38)
Location 11:316361-316383
Sequence GGGACCGGCCAGGCTGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999692_1076999696 -6 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG No data
1076999691_1076999696 -5 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG No data
1076999680_1076999696 27 Left 1076999680 11:316311-316333 CCCAAGGCGGGAGGCGCCGGAGG No data
Right 1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG No data
1076999682_1076999696 26 Left 1076999682 11:316312-316334 CCAAGGCGGGAGGCGCCGGAGGA No data
Right 1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG No data
1076999683_1076999696 11 Left 1076999683 11:316327-316349 CCGGAGGACACACGTGCCCTACG No data
Right 1076999696 11:316361-316383 GGGACCGGCCAGGCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999696 Original CRISPR GGGACCGGCCAGGCTGACCC CGG Intergenic
No off target data available for this crispr