ID: 1076999698

View in Genome Browser
Species Human (GRCh38)
Location 11:316366-316388
Sequence CGGCCAGGCTGACCCCGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999683_1076999698 16 Left 1076999683 11:316327-316349 CCGGAGGACACACGTGCCCTACG No data
Right 1076999698 11:316366-316388 CGGCCAGGCTGACCCCGGCGTGG No data
1076999691_1076999698 0 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999698 11:316366-316388 CGGCCAGGCTGACCCCGGCGTGG No data
1076999692_1076999698 -1 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999698 11:316366-316388 CGGCCAGGCTGACCCCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999698 Original CRISPR CGGCCAGGCTGACCCCGGCG TGG Intergenic
No off target data available for this crispr