ID: 1076999705

View in Genome Browser
Species Human (GRCh38)
Location 11:316390-316412
Sequence CAAGTTTGCCTCCCAGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999699_1076999705 -2 Left 1076999699 11:316369-316391 CCAGGCTGACCCCGGCGTGGACA No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data
1076999695_1076999705 10 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data
1076999692_1076999705 23 Left 1076999692 11:316344-316366 CCTACGCGGGGTGCCGGGGGACC No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data
1076999697_1076999705 2 Left 1076999697 11:316365-316387 CCGGCCAGGCTGACCCCGGCGTG No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data
1076999691_1076999705 24 Left 1076999691 11:316343-316365 CCCTACGCGGGGTGCCGGGGGAC No data
Right 1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999705 Original CRISPR CAAGTTTGCCTCCCAGAGGG CGG Intergenic
No off target data available for this crispr