ID: 1076999708

View in Genome Browser
Species Human (GRCh38)
Location 11:316401-316423
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999700_1076999708 0 Left 1076999700 11:316378-316400 CCCCGGCGTGGACAAGTTTGCCT No data
Right 1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG No data
1076999701_1076999708 -1 Left 1076999701 11:316379-316401 CCCGGCGTGGACAAGTTTGCCTC No data
Right 1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG No data
1076999699_1076999708 9 Left 1076999699 11:316369-316391 CCAGGCTGACCCCGGCGTGGACA No data
Right 1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG No data
1076999702_1076999708 -2 Left 1076999702 11:316380-316402 CCGGCGTGGACAAGTTTGCCTCC No data
Right 1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG No data
1076999697_1076999708 13 Left 1076999697 11:316365-316387 CCGGCCAGGCTGACCCCGGCGTG No data
Right 1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG No data
1076999695_1076999708 21 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999708 11:316401-316423 CCCAGAGGGCGGAGACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999708 Original CRISPR CCCAGAGGGCGGAGACTGAG AGG Intergenic