ID: 1076999710

View in Genome Browser
Species Human (GRCh38)
Location 11:316407-316429
Sequence GGGCGGAGACTGAGAGGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999695_1076999710 27 Left 1076999695 11:316357-316379 CCGGGGGACCGGCCAGGCTGACC No data
Right 1076999710 11:316407-316429 GGGCGGAGACTGAGAGGCGAAGG No data
1076999701_1076999710 5 Left 1076999701 11:316379-316401 CCCGGCGTGGACAAGTTTGCCTC No data
Right 1076999710 11:316407-316429 GGGCGGAGACTGAGAGGCGAAGG No data
1076999699_1076999710 15 Left 1076999699 11:316369-316391 CCAGGCTGACCCCGGCGTGGACA No data
Right 1076999710 11:316407-316429 GGGCGGAGACTGAGAGGCGAAGG No data
1076999702_1076999710 4 Left 1076999702 11:316380-316402 CCGGCGTGGACAAGTTTGCCTCC No data
Right 1076999710 11:316407-316429 GGGCGGAGACTGAGAGGCGAAGG No data
1076999700_1076999710 6 Left 1076999700 11:316378-316400 CCCCGGCGTGGACAAGTTTGCCT No data
Right 1076999710 11:316407-316429 GGGCGGAGACTGAGAGGCGAAGG No data
1076999697_1076999710 19 Left 1076999697 11:316365-316387 CCGGCCAGGCTGACCCCGGCGTG No data
Right 1076999710 11:316407-316429 GGGCGGAGACTGAGAGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999710 Original CRISPR GGGCGGAGACTGAGAGGCGA AGG Intergenic