ID: 1076999712

View in Genome Browser
Species Human (GRCh38)
Location 11:316413-316435
Sequence AGACTGAGAGGCGAAGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076999701_1076999712 11 Left 1076999701 11:316379-316401 CCCGGCGTGGACAAGTTTGCCTC No data
Right 1076999712 11:316413-316435 AGACTGAGAGGCGAAGGGACCGG No data
1076999706_1076999712 -8 Left 1076999706 11:316398-316420 CCTCCCAGAGGGCGGAGACTGAG No data
Right 1076999712 11:316413-316435 AGACTGAGAGGCGAAGGGACCGG No data
1076999699_1076999712 21 Left 1076999699 11:316369-316391 CCAGGCTGACCCCGGCGTGGACA No data
Right 1076999712 11:316413-316435 AGACTGAGAGGCGAAGGGACCGG No data
1076999697_1076999712 25 Left 1076999697 11:316365-316387 CCGGCCAGGCTGACCCCGGCGTG No data
Right 1076999712 11:316413-316435 AGACTGAGAGGCGAAGGGACCGG No data
1076999700_1076999712 12 Left 1076999700 11:316378-316400 CCCCGGCGTGGACAAGTTTGCCT No data
Right 1076999712 11:316413-316435 AGACTGAGAGGCGAAGGGACCGG No data
1076999702_1076999712 10 Left 1076999702 11:316380-316402 CCGGCGTGGACAAGTTTGCCTCC No data
Right 1076999712 11:316413-316435 AGACTGAGAGGCGAAGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076999712 Original CRISPR AGACTGAGAGGCGAAGGGAC CGG Intergenic
No off target data available for this crispr