ID: 1077000535

View in Genome Browser
Species Human (GRCh38)
Location 11:320053-320075
Sequence GGGGAGAGCCAATGAGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 9, 3: 49, 4: 505}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077000535_1077000545 18 Left 1077000535 11:320053-320075 CCGTCTCCTCATTGGCTCTCCCC 0: 1
1: 0
2: 9
3: 49
4: 505
Right 1077000545 11:320094-320116 ACCTCCTCCCCTTCCTCACCCGG 0: 3
1: 1
2: 5
3: 90
4: 617
1077000535_1077000538 -8 Left 1077000535 11:320053-320075 CCGTCTCCTCATTGGCTCTCCCC 0: 1
1: 0
2: 9
3: 49
4: 505
Right 1077000538 11:320068-320090 CTCTCCCCGCCCTGAGATCAGGG 0: 1
1: 0
2: 2
3: 18
4: 168
1077000535_1077000537 -9 Left 1077000535 11:320053-320075 CCGTCTCCTCATTGGCTCTCCCC 0: 1
1: 0
2: 9
3: 49
4: 505
Right 1077000537 11:320067-320089 GCTCTCCCCGCCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 12
4: 160
1077000535_1077000547 19 Left 1077000535 11:320053-320075 CCGTCTCCTCATTGGCTCTCCCC 0: 1
1: 0
2: 9
3: 49
4: 505
Right 1077000547 11:320095-320117 CCTCCTCCCCTTCCTCACCCGGG 0: 2
1: 1
2: 16
3: 148
4: 1128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077000535 Original CRISPR GGGGAGAGCCAATGAGGAGA CGG (reversed) Intronic
900323431 1:2095928-2095950 GGGGAGGGGAAAGGAGGAGAGGG - Intronic
900369255 1:2324115-2324137 GGGGAGAGCCACGGAGGAGCAGG - Exonic
901086832 1:6615551-6615573 GGGGAGAGCCGGTGGGGAAATGG - Intronic
901177236 1:7313274-7313296 TGGGAGAGGGAAAGAGGAGATGG - Intronic
901240710 1:7691554-7691576 TGTGAGAGCCACCGAGGAGATGG + Intronic
901681664 1:10916393-10916415 GGGGAGAGCCAGGGAGGAAGTGG + Intergenic
902361858 1:15946265-15946287 CAAGAGAGCCAAAGAGGAGAAGG - Exonic
902761141 1:18581496-18581518 GGGGTGAGCTCTTGAGGAGAGGG - Intergenic
903008596 1:20314675-20314697 GGGGGGAGACAGGGAGGAGATGG + Intronic
903167411 1:21530614-21530636 AGGGAGAAACAGTGAGGAGAAGG + Intronic
903322666 1:22552214-22552236 GGGGAGAACCAGAGAGGAGAGGG + Intergenic
903408944 1:23123682-23123704 AGGGAGAGCTACTGAGGACAGGG - Intronic
903455284 1:23483428-23483450 TGGGAAAGACAAAGAGGAGAGGG + Intronic
903515632 1:23909074-23909096 TGGGTGAGCCCATGAGCAGAGGG - Intronic
903676881 1:25069975-25069997 GGGGAGAGACAATGAAGAGAGGG - Intergenic
904062174 1:27720289-27720311 AGGGACAGACAATGAGGAGAAGG - Intergenic
904357164 1:29947808-29947830 GGAGAGAAACAAGGAGGAGATGG - Intergenic
904753875 1:32757410-32757432 GGGGAGAGGTGATGAGGTGAGGG + Intronic
904824423 1:33265329-33265351 GGGGAGGGACAGTGAGGGGAAGG + Intronic
904998207 1:34647717-34647739 GGGGAAACCAAGTGAGGAGAAGG + Intergenic
905013058 1:34759923-34759945 GGGAAGTGCCAAGGAGGAGAAGG + Intronic
905480771 1:38260526-38260548 GGGGAGAGAAAAGGAGTAGAGGG - Intergenic
906497644 1:46316849-46316871 GGGGAGCGGCAAGGAGGACAGGG + Intergenic
907817773 1:57937214-57937236 GGGGTGAGCCAAGGAGGGAAGGG + Intronic
907946114 1:59138033-59138055 GGGGAGAGCCAAGGAGGAGGTGG - Intergenic
910441124 1:87253011-87253033 GTGGAGAGGCCATGTGGAGAGGG + Intergenic
910575701 1:88760997-88761019 GGAGAGGGCCAATGAAAAGATGG + Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
912547476 1:110461263-110461285 GGTGAGACCCAAGGAGGAGCAGG + Intergenic
913294704 1:117308095-117308117 GTGGATAGCAAAAGAGGAGAAGG + Intergenic
914835868 1:151206478-151206500 GGCGAGAGGGAATGAGAAGAGGG + Intronic
914936195 1:151982516-151982538 TAGGAGAACCAATCAGGAGAGGG - Intergenic
914954923 1:152153235-152153257 CTGGGGAGCCACTGAGGAGAAGG + Intergenic
915477363 1:156161063-156161085 GAGGAGAACCAATAGGGAGATGG + Intronic
916028863 1:160859285-160859307 GAGGAGAGACAAAGAGGAGTGGG + Intronic
916452440 1:164933959-164933981 GAGGAGAGGCAGAGAGGAGAAGG - Intergenic
916463747 1:165051690-165051712 CAGGAGAGACAATGTGGAGATGG - Intergenic
916562562 1:165945900-165945922 GGGGAGGGCCAATAAGGCAAGGG - Intergenic
916804321 1:168243827-168243849 AGGGAGGGCCAGGGAGGAGATGG - Exonic
917598402 1:176552450-176552472 GAGGAGAGGGGATGAGGAGATGG - Intronic
918463377 1:184797937-184797959 GGAGACAGACAGTGAGGAGAGGG - Intronic
918866946 1:189913745-189913767 GAGAAGAGAAAATGAGGAGAGGG - Intergenic
919157985 1:193791414-193791436 GAGGAGAGACAAAGAGAAGAAGG - Intergenic
919881792 1:201905839-201905861 GGGCAGAGCCAAGGAGGGCAGGG + Intronic
920191874 1:204198994-204199016 GACAAGAGCCCATGAGGAGAGGG - Intronic
920371762 1:205483563-205483585 AGGGGGAGCCAGTGTGGAGAGGG - Intergenic
920540695 1:206775802-206775824 GGCAAGAGCCCATGAAGAGAGGG + Intergenic
921542013 1:216427980-216428002 AGAGAGAGGCAATGGGGAGAGGG + Intergenic
921603950 1:217135371-217135393 GGGTAGGGCCAAAGAGGTGAGGG + Intronic
922267576 1:223998906-223998928 GGGAAGAGCCTATTAGGAAATGG + Intergenic
922431517 1:225559774-225559796 GGGGAGGGCCATTGTGGATATGG - Intronic
923043506 1:230337076-230337098 GTGGGGAGCCAGTGAGGATACGG - Intronic
923482203 1:234396268-234396290 GGGTAGAGCCTGGGAGGAGAGGG - Intronic
924436084 1:244044287-244044309 GGGGAGAGAGAATGAGAAGAGGG + Intergenic
1062818003 10:515353-515375 TGGAAGAGCCTAGGAGGAGAGGG - Intronic
1063805590 10:9635874-9635896 GGAGAGAAGCAATGAGAAGAAGG - Intergenic
1064302160 10:14132409-14132431 GGGCAGAGCAAATGTGGAGAGGG + Intronic
1065145261 10:22762090-22762112 AGAGAGAAACAATGAGGAGATGG - Intergenic
1066512539 10:36117864-36117886 GGGGTGTGGCAAGGAGGAGAAGG - Intergenic
1066745508 10:38602228-38602250 CGGGAGAGCGGAGGAGGAGAGGG + Intergenic
1067531041 10:47073319-47073341 GGGGAAAGCCAATCTGGAGGTGG + Intergenic
1067739980 10:48888258-48888280 GGGGAGAGGAAAGGAGGGGAGGG - Intronic
1067801005 10:49359727-49359749 GAGGGAAGCCAATGGGGAGAGGG + Intergenic
1069752095 10:70751464-70751486 GGGGAGAGCCTGAGGGGAGATGG - Exonic
1070039093 10:72757218-72757240 GCTGAGAGCCAAATAGGAGATGG + Intronic
1070297265 10:75173013-75173035 TAGGACAGCCACTGAGGAGAGGG + Intronic
1070523747 10:77277066-77277088 GGGCAGAGACAATGAAGAGAAGG - Intronic
1070743270 10:78916496-78916518 GGGGTGCGCCAAAGAGAAGAAGG - Intergenic
1072167880 10:92831228-92831250 GGGGAGAGCTGAGGAGCAGAGGG + Intergenic
1072323671 10:94275192-94275214 AGGGAGGGCCAATGAGAAGGAGG - Intronic
1072616224 10:97050382-97050404 GGGCAGAGCCCAGGAGGTGATGG - Intronic
1073249854 10:102114756-102114778 GGGGAGAGCCGAGAAGGAGGAGG - Intronic
1073266863 10:102232921-102232943 GGGGAGAGAGAATGAGGTAAAGG - Intronic
1074191179 10:111139160-111139182 ATGGAGAGCCATTGAGAAGAAGG - Intergenic
1074237222 10:111597796-111597818 GGGGATATCCAAAGAGGAGCTGG - Intergenic
1074639922 10:115368632-115368654 GGGGATGGGAAATGAGGAGATGG - Intronic
1074915854 10:117954356-117954378 GGGGAGAGGAGAGGAGGAGAGGG - Intergenic
1074924426 10:118053134-118053156 GGGGAGGGGAAAGGAGGAGAGGG - Intergenic
1075092348 10:119450907-119450929 GGGGAGGGCCAGTGGGGAAAAGG - Intronic
1075577170 10:123585765-123585787 GGGCAGAGACAATGAAGAGAGGG + Intergenic
1075688643 10:124380569-124380591 GGGGAGAAGCATGGAGGAGATGG - Intergenic
1075703399 10:124483833-124483855 GGGGAGAGGCAATGAAAAGGGGG + Intronic
1076392118 10:130110851-130110873 CTGGGGAGCCAATAAGGAGAGGG + Intergenic
1076674696 10:132141919-132141941 GGGCATGGCCAAGGAGGAGACGG + Exonic
1077000535 11:320053-320075 GGGGAGAGCCAATGAGGAGACGG - Intronic
1077539406 11:3139517-3139539 GGGGAAAGCCAGTGAGCAGGGGG + Intronic
1077722628 11:4643718-4643740 GAGGAGAGGCAATGGGGAAAGGG - Exonic
1077869814 11:6252218-6252240 GGGCTGAGCCAATGGGGAAAAGG + Intergenic
1079326001 11:19493180-19493202 GGGAAGAACCAATTAGGAGGAGG - Intronic
1079411772 11:20194287-20194309 GGAGAGAACTAATGAGGAGGAGG - Intergenic
1080857405 11:36124210-36124232 GGGTAGAGACAAAAAGGAGAAGG - Intronic
1081489478 11:43556514-43556536 GGGGAGAGCCAAAGGGAAGGAGG - Intronic
1082990845 11:59206037-59206059 GGGGAGATGCAATGAGGTGAGGG + Exonic
1083896809 11:65624168-65624190 GGGGTCAGCCCATGAGGAGCTGG - Intronic
1084492546 11:69486659-69486681 GGGGACAGCCTATGGGGACAGGG + Intergenic
1084515167 11:69634077-69634099 GGGGAGAAACAGGGAGGAGATGG - Intergenic
1084753765 11:71221921-71221943 TGGGAGAGCCACTGAGGAGTAGG + Intronic
1084781020 11:71408133-71408155 GGGGAGACCCCAAGAGGAGCTGG + Intergenic
1085350443 11:75794979-75795001 GGGGAGAGGAACGGAGGAGAGGG - Intronic
1085781271 11:79411299-79411321 GGGGAGAGCCATTTAGCACAAGG - Intronic
1086002533 11:81999790-81999812 GGGGAGGGGAAAGGAGGAGATGG + Intergenic
1086144976 11:83541704-83541726 GGAGGGAGACAGTGAGGAGATGG - Exonic
1086264578 11:84982516-84982538 TGGGACAATCAATGAGGAGATGG - Intronic
1086307138 11:85493698-85493720 GGGGAGAGAAAAGGAGGGGAGGG + Intronic
1086544721 11:87954337-87954359 AGGGAGAGACAGAGAGGAGATGG - Intergenic
1086609847 11:88742609-88742631 GTGAAGAGCCTATGAGGAGAGGG + Intronic
1087064282 11:94012484-94012506 GGGGAGAGCAGATGAAGAGGTGG + Intergenic
1087542691 11:99541482-99541504 CTGGAGGGCCAAAGAGGAGATGG + Intronic
1087557192 11:99735920-99735942 GGGGAGGATGAATGAGGAGACGG - Intronic
1087910776 11:103751073-103751095 TGGGAGAGATAATGAGGTGATGG + Intergenic
1088287189 11:108201238-108201260 GGGGAGAGGAAAAGAGGAGATGG - Intronic
1088484544 11:110328342-110328364 GGGGAGGGGAAGTGAGGAGAGGG - Intergenic
1088703714 11:112440795-112440817 GGGAAGATCCAAGGAGGATATGG + Intergenic
1088879915 11:113965045-113965067 GAGATGAGACAATGAGGAGAGGG - Intergenic
1090008872 11:123027939-123027961 GTGGTGATCCAAAGAGGAGATGG + Intergenic
1090756100 11:129793200-129793222 TGGGAGATCCAAGGATGAGAGGG - Intergenic
1090950927 11:131472649-131472671 GGGTAAAGGCAATGAGGAGAAGG + Intronic
1090978822 11:131698623-131698645 GGAGAAAGCCAAGGAGGAGAAGG + Intronic
1091094171 11:132803169-132803191 GGGGAGAACAGATGAAGAGAGGG - Intronic
1091319233 11:134638076-134638098 TGGGACAGCCAAGGAGGAAAAGG - Intergenic
1092927613 12:13286212-13286234 GGGGAGAGTAAATGGGGAGATGG + Intergenic
1096531530 12:52245622-52245644 GAGGAGAGCCGGTGAGGACAAGG + Exonic
1096548820 12:52359138-52359160 GGTGACAGCTAATGGGGAGATGG + Intergenic
1097514876 12:60592858-60592880 AGAGAGAGCCAATGAAGAAAAGG + Intergenic
1097938488 12:65278885-65278907 GGGGTGAGGCGAGGAGGAGAGGG - Intronic
1098230361 12:68366805-68366827 GGGCAGTGCTGATGAGGAGAGGG - Intergenic
1099050644 12:77778176-77778198 GGGGAGAGGAGAGGAGGAGAGGG - Intergenic
1099643372 12:85319481-85319503 GGGGAGAGGAAGGGAGGAGAGGG - Intergenic
1099950841 12:89302034-89302056 GGGAAGAGCCAGTGATCAGAGGG + Intergenic
1101930955 12:109013826-109013848 GGGGAGAGGGAATGGGGAGTTGG - Intronic
1102081611 12:110102860-110102882 GGGGAGATTCAAGGAGGAGAAGG - Intergenic
1102233837 12:111281854-111281876 GGGGAGAGAGAAGGAGGAGGCGG + Intronic
1102410642 12:112715240-112715262 GTAGAGAGCTAATGATGAGAAGG - Intronic
1102465591 12:113129279-113129301 GGGGAGAGACAATGAGGACAAGG + Intronic
1102727401 12:115077811-115077833 GGAGACAGGCAGTGAGGAGAGGG - Intergenic
1102808793 12:115805680-115805702 GGGGAAAGACAAAGAGTAGAAGG + Intergenic
1102987896 12:117293398-117293420 GGGGAGAGTCAGTGATGAGTTGG - Intronic
1103418488 12:120760886-120760908 GGGATGTGCCAATGAAGAGAAGG - Intergenic
1104161604 12:126186458-126186480 GAGGAGAGACTAAGAGGAGAAGG - Intergenic
1104301402 12:127568370-127568392 GGAGAGAGACAGAGAGGAGAGGG + Intergenic
1105643890 13:22295730-22295752 TGGGTGTGACAATGAGGAGAAGG + Intergenic
1105754186 13:23449684-23449706 GGGGAGAGCCGGAGAGGAAATGG + Intergenic
1106540988 13:30690092-30690114 GGGGGGAGCCAGAAAGGAGATGG - Intergenic
1107060384 13:36153954-36153976 GGGCAGAGCCAGTGACAAGAAGG + Intergenic
1107119816 13:36784344-36784366 TGTTAGAGCCACTGAGGAGATGG + Intergenic
1107659855 13:42627431-42627453 GGGGAGGGGGAATGAGGAGAGGG + Intergenic
1107806383 13:44157588-44157610 GGGGAGTGCAAATGAGAAAAAGG - Intronic
1108326478 13:49337431-49337453 TGGGAGAGCCCCTGAGGGGAGGG - Intronic
1108598729 13:51972505-51972527 GGGGAGGGCCATGGAGGAAAGGG - Intronic
1109756429 13:66766646-66766668 GGGGAAAGGGAAGGAGGAGAGGG + Intronic
1109924585 13:69119837-69119859 GGGGAGGGGCAATGGGGCGAAGG + Intergenic
1111189339 13:84788456-84788478 GGCGAGAGACAAAGAGCAGAAGG - Intergenic
1111813080 13:93116391-93116413 AGGGAGACCTGATGAGGAGAAGG - Intergenic
1112456233 13:99566219-99566241 TGGGAGAGGCAAGGAGAAGAGGG - Intergenic
1112609699 13:100944541-100944563 AGGTAGAGCCAATGAGTAGCTGG + Intergenic
1112749210 13:102565073-102565095 GAGTAGAGCCAAGGAAGAGATGG + Intergenic
1113159582 13:107364943-107364965 GGAGAGAGAAAATGAGGAGGGGG - Intronic
1113648927 13:112020103-112020125 GGGGAGTGACAATGAGGGGGAGG - Intergenic
1114381508 14:22209975-22209997 GGGGAGAAAAAAAGAGGAGAAGG - Intergenic
1114526551 14:23370320-23370342 GGGGGGTGGCAATGGGGAGAAGG - Intergenic
1114701234 14:24680632-24680654 TGTGGGAGCCACTGAGGAGAAGG + Intergenic
1115336753 14:32249876-32249898 GGAGAGAGAAACTGAGGAGAGGG + Intergenic
1117134655 14:52722309-52722331 GGGGAATGCCGATGAGGAGTTGG + Intronic
1117399474 14:55345552-55345574 TGTGAGAGCCCATGGGGAGACGG - Intronic
1117652217 14:57918835-57918857 GGAGTGAGTCAATTAGGAGATGG + Intronic
1118095411 14:62531851-62531873 GGTGAGAGCAGATGAAGAGATGG + Intergenic
1118763528 14:68895136-68895158 TGGGAGAACCAATAAGGAGAAGG + Intronic
1119217034 14:72876920-72876942 GGGGAGAGGGAAGGAGGAAAAGG - Intronic
1119531564 14:75364994-75365016 GGGGAGAGAAAATGAGGAGGAGG + Intergenic
1119687297 14:76643075-76643097 GGGCAGAGACAGTGAGGAGGTGG - Intergenic
1120998700 14:90436114-90436136 GGAGAGAGACAAAGAGGAGGAGG + Intergenic
1121396478 14:93628211-93628233 GTTGAGAGCCAATGAGGACTAGG - Intronic
1121971587 14:98362095-98362117 CAGGAGAGCCAATGTGTAGAAGG + Intergenic
1122809816 14:104282332-104282354 GGGGCGATGCAATGAGGAGAGGG + Intergenic
1123087678 14:105724410-105724432 GGGGAGAGCAGAAGAGCAGAAGG - Intergenic
1123570126 15:21596463-21596485 AGGGAAAGCCCATGAGGATAAGG + Intergenic
1123606238 15:22031783-22031805 AGGGAAAGCCCATGAGGATAAGG + Intergenic
1123724327 15:23087052-23087074 GAGGAGAGGCAAAGGGGAGAGGG + Intergenic
1124461961 15:29900246-29900268 GGGGAAAGAGAAGGAGGAGATGG + Intronic
1125046428 15:35246442-35246464 GGGGAAAGGAAATGGGGAGATGG - Intronic
1126670952 15:51114470-51114492 TGGGAGAAGGAATGAGGAGATGG - Intergenic
1127213701 15:56802032-56802054 GGGGAAAGGAAGTGAGGAGAAGG - Intronic
1127757919 15:62111310-62111332 GGGCTGAGCCCATGAGGAGATGG + Intergenic
1128236545 15:66071449-66071471 GCTGAGAGCAAATGTGGAGAAGG + Intronic
1129177158 15:73848322-73848344 GAGGAGTGCCAGTGAGGTGACGG - Intergenic
1129583631 15:76838902-76838924 TGTGAGAACAAATGAGGAGATGG + Intronic
1129985816 15:79919224-79919246 GAGGAGAGCAAAGGAGGCGAAGG - Intronic
1130551982 15:84895155-84895177 GGGGAGGGCCCATGAGCTGAGGG + Intronic
1130770800 15:86921603-86921625 GGGGAGGGAGAATGAGGAGGAGG + Intronic
1131107573 15:89745224-89745246 GGGGAGAGCGGGTGGGGAGAGGG + Intergenic
1131343814 15:91627669-91627691 GGGAAGAACCAGTGAAGAGAAGG + Intergenic
1202978477 15_KI270727v1_random:323556-323578 AGGGAAAGCCCATGAGGATAAGG + Intergenic
1133312666 16:4860286-4860308 GGTGAGACCAAGTGAGGAGAAGG - Intronic
1134832702 16:17336601-17336623 GGGGTGAGCCTAGGAGGAGGAGG - Intronic
1136367827 16:29816960-29816982 GGAGAGATCCGATGAGGAGCCGG + Exonic
1136403519 16:30030788-30030810 GGGGAGAGGCAAAGAGGGGATGG + Exonic
1137700626 16:50495436-50495458 GGGGAAAGTCTGTGAGGAGAAGG - Intergenic
1137783692 16:51119644-51119666 GGGGAGAGGAGATGAGGAGAAGG + Intergenic
1138298354 16:55906247-55906269 GGTGAGAGCATTTGAGGAGACGG + Intronic
1139693422 16:68656107-68656129 GGGGAGAGCCAGTGAGGCATAGG + Intronic
1139788882 16:69415999-69416021 GTGCAGAGCCAATGAGTAAATGG - Intergenic
1140708204 16:77650969-77650991 GTGGTGAGCAAATGAGAAGACGG - Intergenic
1140729455 16:77843168-77843190 GGGCAGAGGCAATGAGCAGATGG - Intronic
1141326971 16:83069698-83069720 GGGGAGAGCCAATCAGGGTGAGG - Intronic
1141424673 16:83937080-83937102 GGGGAGAGCCCAAGATGAGGGGG - Intronic
1142105153 16:88298713-88298735 CTGGAGAGCCAGTGAGGAGTGGG - Intergenic
1142256715 16:89017463-89017485 GGGGAGGGTGAATGAGGAGGTGG + Intergenic
1142256741 16:89017533-89017555 GGGGAGGGTGAATGAGGAGGTGG + Intergenic
1142498589 17:320029-320051 GGGGAGGGACATTGAGGGGAGGG + Intronic
1142498600 17:320054-320076 GGGGAGGGACATTGAGGGGAGGG + Intronic
1142498620 17:320104-320126 GGGGAGGGACATTGAGGGGAGGG + Intronic
1142498631 17:320129-320151 GGGGAGGGACATTGAGGGGAGGG + Intronic
1142498642 17:320154-320176 GGGGAGGGACATTGAGGGGAGGG + Intronic
1142498653 17:320179-320201 GGGGAGGGACATTGAGGGGAGGG + Intronic
1142498664 17:320204-320226 GGGGAGGGACATTGAGGGGAGGG + Intronic
1142906783 17:3048980-3049002 GGCGACAGCCAATGAGGAGATGG - Intergenic
1143523697 17:7460883-7460905 GGGGAGTGACACTGGGGAGATGG + Exonic
1143580955 17:7825627-7825649 GGGGAGGGCCAAAGAGGGGAGGG + Intronic
1144301595 17:13926552-13926574 GGGGAGGGGAAAGGAGGAGATGG - Intergenic
1145056431 17:19706706-19706728 GGGGACAGCCAGGGAGAAGAAGG + Exonic
1146352196 17:32104162-32104184 GGGGGGAGTAAATGGGGAGATGG - Intergenic
1147043553 17:37736145-37736167 GGGGAAATCCAAGGGGGAGAAGG + Intronic
1147169445 17:38609423-38609445 GGGAGGAGCCAAGGAGGAGGAGG + Intergenic
1148317086 17:46711119-46711141 GGTGAGAATGAATGAGGAGATGG + Exonic
1148739774 17:49886197-49886219 GGGGAGAGGCAGGGAGGGGAAGG + Intergenic
1148767443 17:50047395-50047417 GGAGAGAGCCATTGTGGGGATGG + Intergenic
1148899957 17:50867605-50867627 GGGGGGAGCGAAGGAGGGGACGG + Intronic
1149683446 17:58521200-58521222 GGGGAGAGCCACTGAGGGCAAGG + Intronic
1150595843 17:66603755-66603777 GGGGAGGGAAAATGAGGAGCTGG - Intronic
1151182017 17:72336184-72336206 GGGCAGGGCCAATGAGGAACTGG - Intergenic
1151418253 17:73980889-73980911 AGGGAGAGCAACTGGGGAGAAGG + Intergenic
1151462108 17:74260518-74260540 GGGGAGTGGCAGTGAGGAGGGGG + Exonic
1151854900 17:76714089-76714111 GGGGAGAGCCACTGAAAAGAGGG - Exonic
1152472117 17:80495473-80495495 GGGGAGGGCGAATGGGGAGTTGG - Intergenic
1155000426 18:21680795-21680817 GAGGAGAGAAAAAGAGGAGAAGG - Intronic
1157511527 18:48278853-48278875 GGGGACAGCCTGTGAGGAGCTGG - Intronic
1157582682 18:48782583-48782605 GGGGAAAGCGAATGCTGAGAAGG - Intronic
1160051552 18:75438671-75438693 GGGGAGAGCCACTGGGAAAAGGG + Intergenic
1160859581 19:1232010-1232032 GGTGGGGGCCAACGAGGAGAGGG + Intronic
1160982311 19:1822032-1822054 GGGCAAAGCCAATGAGCAGGTGG - Intronic
1161403979 19:4081714-4081736 GAGGAGAGGCAAGGAGGAGGAGG - Intergenic
1161403999 19:4081783-4081805 GAGGAGAGGCAAAGAGGAGAAGG - Intergenic
1161847622 19:6720712-6720734 GGGGAGAGGCCATGGGGAGAAGG - Intronic
1162401431 19:10449050-10449072 GGGGAGCGGCAGTGAGGAGTGGG - Intronic
1162718378 19:12647760-12647782 GGACTGAGCCAATGGGGAGATGG + Intronic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1164950713 19:32334518-32334540 AGGGAGAGACAGTGAGGACACGG + Intergenic
1164999025 19:32745246-32745268 GGGAAGAGCCCATGCAGAGAAGG - Intronic
1165265904 19:34663881-34663903 GGGAAGAGACAATGGGGAGAAGG + Intronic
1166046585 19:40233973-40233995 GGGGAGGACCAGTCAGGAGAGGG + Intronic
1166305551 19:41935158-41935180 GGGAAGAGAGAAGGAGGAGATGG + Intergenic
1166517901 19:43461100-43461122 GCGGAGAGACAAGGATGAGAAGG + Exonic
1166689027 19:44811922-44811944 AGGGAGAGACCAAGAGGAGAAGG + Intronic
1167081835 19:47281493-47281515 GGGGAGGGGGAATGGGGAGATGG - Intergenic
1167426600 19:49432790-49432812 AGGTAGAGCCCAGGAGGAGAGGG - Exonic
1167620698 19:50558808-50558830 GGGCAGGGCCAAGGAGCAGACGG - Intronic
1167689891 19:50978832-50978854 GGAGAGAGAGAAAGAGGAGAGGG + Intronic
1167765490 19:51479585-51479607 GGGGGGAGCCCAGGAGGAGCTGG + Intronic
1168264040 19:55211764-55211786 GGGAAGAGACAGTGAGGAGGAGG - Intergenic
1168333892 19:55586017-55586039 CAGGAGAGCCAATGAGGAGGGGG - Intergenic
1168419256 19:56190549-56190571 GGTGAGAGCAAAGGAGGGGAAGG - Exonic
1168423713 19:56222297-56222319 GGTGAGAGCAAAGGAGGGGAAGG - Exonic
925248740 2:2410443-2410465 GTGGGGAGAGAATGAGGAGATGG + Intergenic
926609016 2:14926759-14926781 GGGGAGAGAGAATGGGGAGTTGG - Intergenic
927155654 2:20219807-20219829 GGGGACAGCCCATGAGGAACTGG - Intronic
927949657 2:27159023-27159045 GGGGAGAGAAAAGGAGTAGAAGG + Intergenic
928075598 2:28261754-28261776 GGGGAGGGGAAAGGAGGAGAGGG - Intronic
928331986 2:30364660-30364682 GGGGAGAGGAAGAGAGGAGAAGG + Intergenic
929080071 2:38113671-38113693 AGGGAGAACCAAAGAGGTGAGGG + Intergenic
929693858 2:44097757-44097779 TGGGGGAGGCGATGAGGAGAGGG + Intergenic
929833644 2:45373913-45373935 GAGGAGGGGGAATGAGGAGAAGG - Intergenic
930466294 2:51754653-51754675 GGAGAGAGGAAATCAGGAGAAGG - Intergenic
931263325 2:60638829-60638851 GGGTAGAGCCCATGAGGAGAGGG - Intergenic
931934874 2:67185962-67185984 AGGGAAAGCAAATGAAGAGAAGG + Intergenic
932165843 2:69506064-69506086 TAGGAGAGCAAATGAGAAGAGGG + Intronic
932398863 2:71466196-71466218 GGCGAGAGGCAATGAGGCGGGGG + Intronic
932742452 2:74302193-74302215 TGGGAGAGCCTAGGAGGACAGGG - Intronic
933807707 2:86012158-86012180 GGGGAGACCCAAGCAGGAGTAGG - Intergenic
933877532 2:86633540-86633562 GGGGAGAGCAGATGTGGAGAGGG + Intronic
935182180 2:100701150-100701172 GGAGAAACCCAATGAAGAGAAGG - Intergenic
935358463 2:102226748-102226770 GGGGAGAGAGATGGAGGAGAAGG + Intronic
935637705 2:105262358-105262380 GGAGAGAGACAGTGAGGAGGAGG - Intergenic
936230039 2:110692561-110692583 GTGGAGAGGCAAGGAGAAGATGG + Intergenic
936356556 2:111756862-111756884 GGGGAGGGGAAGTGAGGAGAGGG + Intergenic
937250252 2:120519355-120519377 GGGGAGAATGAAGGAGGAGAGGG - Intergenic
937283740 2:120737009-120737031 GGGGAGAGACGATGAGTAGGGGG - Intronic
937342944 2:121103571-121103593 GGGTAGAGAGAATGAGGGGAAGG + Intergenic
937952385 2:127398442-127398464 GGAGAGAGCCAATGACTGGAGGG - Intergenic
938836031 2:135105191-135105213 GGGGAGAGGGAAGGGGGAGAGGG - Intronic
939612986 2:144332447-144332469 AGGGAGAGACAAGGAGGAGGAGG - Intronic
940039935 2:149349434-149349456 GGTTAGAGAAAATGAGGAGAGGG + Intronic
940367309 2:152862386-152862408 GCTAAGAGCCAAAGAGGAGAGGG + Intergenic
940683609 2:156818604-156818626 GTGGAAAGCCAATTAGGAAAGGG + Intergenic
942209887 2:173659757-173659779 GGGGTGGGTCACTGAGGAGATGG - Intergenic
943383063 2:187173975-187173997 GGGGAGGGGGAAGGAGGAGATGG + Intergenic
943530946 2:189079587-189079609 GAGAAGAAACAATGAGGAGAAGG + Intronic
943805242 2:192116318-192116340 GGGGAGAGATACTGAGGAAATGG + Intronic
944153349 2:196585668-196585690 GGAGAGAACAAAGGAGGAGAAGG + Intronic
945126064 2:206511437-206511459 GAGGAGAGCCAGTGGGGACAGGG + Intronic
945689807 2:213019680-213019702 GGGTAAAACCAAAGAGGAGAAGG - Intronic
945988074 2:216371044-216371066 GGGGAAAGCCAATTAGGAGAAGG + Exonic
946162602 2:217845167-217845189 GAGGACAGCCAATGGGGAAAAGG + Intronic
946273025 2:218609901-218609923 GGGGAGAAGGGATGAGGAGAAGG + Intronic
948822271 2:240556039-240556061 GTGGGGAGCCAATGAGAAGGCGG - Intronic
1168935731 20:1664021-1664043 GGTGAGAGACAAAGAGGAGCTGG + Intergenic
1169549623 20:6688761-6688783 AGGGGGAGCCAATGAGGAGATGG + Intergenic
1169597838 20:7221051-7221073 GGGGAGAGGAAAAGAGTAGAGGG - Intergenic
1169597845 20:7221076-7221098 GGGGAGAGGAAAAGAGTAGAGGG - Intergenic
1169657678 20:7943005-7943027 AGGGAGCACCAATGAGGAGTAGG - Intergenic
1170140853 20:13123856-13123878 TGGGGAAGCCAATGAGGAGTGGG - Intronic
1170625130 20:18024628-18024650 GAGGAGAGGAAGTGAGGAGAAGG - Exonic
1170732335 20:18985899-18985921 TGGGAGGGTCAAAGAGGAGAGGG + Intergenic
1172029311 20:31970304-31970326 GGGGATAGCCAGTGAGTCGAGGG - Intronic
1172824118 20:37765855-37765877 GGGGAGATTCAAGGAGGAGAAGG - Intronic
1172972256 20:38882181-38882203 GGGCAGAGAGAATGAGGAGTGGG + Intronic
1173427403 20:42954995-42955017 GGGAAGGGCCAGGGAGGAGAGGG + Intronic
1173662380 20:44743727-44743749 GGGGAGAGTTAATGAGGGCATGG - Intergenic
1173862112 20:46290706-46290728 GGGGAGGGAGAAGGAGGAGAGGG + Intronic
1173878290 20:46390806-46390828 GAGGAGAGGCAAAGGGGAGAGGG - Intronic
1174794710 20:53512349-53512371 TGGGAGAGCAAAAGAGTAGAAGG - Intergenic
1175195608 20:57241429-57241451 GGGGAGGGGTAATGAGGAGATGG - Intronic
1175954564 20:62602771-62602793 GGGGAGAGCCAGGGAAGAGAGGG - Intergenic
1175954605 20:62602888-62602910 GGGGAGAGCCGGGGAAGAGAGGG - Intergenic
1175996736 20:62815343-62815365 GGGGAGAGCCACTGAGGAGGGGG + Intergenic
1176126732 20:63478867-63478889 GGGGAGACCCCAAGAGGACATGG + Intergenic
1177667158 21:24175526-24175548 GGCTAGAGGCAATGAGCAGAAGG - Intergenic
1178585327 21:33866494-33866516 GGGGAGAGGTGAAGAGGAGAGGG - Intronic
1179438663 21:41378866-41378888 GAGGGGAGCCAGGGAGGAGAAGG - Intronic
1179943335 21:44653954-44653976 TGGGAAAGACACTGAGGAGAAGG + Intronic
1179986901 21:44927235-44927257 GGAGAGGGCCAGTGGGGAGAGGG + Intronic
1180076958 21:45467853-45467875 GGGCAGAGCCAGTGGGGAGAAGG - Intronic
1180307881 22:11144716-11144738 GGGGAGAGGAATGGAGGAGAGGG - Intergenic
1180534987 22:16388501-16388523 CGGGAGAGCTGAGGAGGAGAGGG + Intergenic
1180546357 22:16506529-16506551 GGGGAGAGGAATGGAGGAGAGGG - Intergenic
1181035419 22:20167733-20167755 GGGGAGAGCCCAGTAGGCGATGG + Intergenic
1181048000 22:20224619-20224641 GGGGAGAGCCAGGGACCAGAGGG + Intergenic
1181308190 22:21928771-21928793 GGGGAGAGACCAGGAGGAAAGGG - Intronic
1181508529 22:23378122-23378144 GAGGAAAGCCACTGAGGAAAGGG + Intergenic
1181775970 22:25160525-25160547 AGGGAGAGCAGAAGAGGAGAGGG - Intronic
1181813620 22:25420838-25420860 CGGGGCAGCCAAGGAGGAGAAGG + Intergenic
1181850645 22:25747585-25747607 GGGGAGAGCCAATGGGCTGGAGG + Intronic
1181885936 22:26022585-26022607 GAGGAGAGACAAGGAAGAGAGGG - Intronic
1182017831 22:27055730-27055752 GGGGATAGAGAATGAGGAGATGG + Intergenic
1182050959 22:27312141-27312163 GGGGAGAGAGAGAGAGGAGACGG + Intergenic
1182342725 22:29637044-29637066 CAGGAGAGCCTGTGAGGAGAAGG - Intronic
1182355204 22:29719811-29719833 GAGGAGAGCCAGTGAACAGAGGG + Intergenic
1183057210 22:35314353-35314375 GGGCAGAGCCAATCAGAAGACGG - Intronic
1183305116 22:37078754-37078776 GGAGAAAGAGAATGAGGAGAAGG + Intronic
1184489032 22:44798750-44798772 GGCGAGTGCCACTGAGGAGCTGG + Intronic
1184536932 22:45093945-45093967 GGAGTGGGCCAAGGAGGAGAGGG - Intergenic
1184728071 22:46357763-46357785 GGGGACACCCAGTGGGGAGATGG - Intergenic
1184942698 22:47780797-47780819 GGGCAGAGCCACTGAGGGGCTGG - Intergenic
1185089344 22:48757130-48757152 GGAGAGAGGCAAGGAGGAGGAGG + Intronic
1185161518 22:49232799-49232821 GGGGTGAGCCGATGAGGAGAAGG + Intergenic
949656574 3:6227439-6227461 GGGAAGATACAATGAGAAGATGG + Intergenic
949991474 3:9582878-9582900 GAGGACAGCAAATCAGGAGACGG + Intergenic
950216314 3:11162244-11162266 GGGAGGAGCCATTGAGGAGCTGG + Intronic
951411940 3:22376213-22376235 GGGGAGAGCCATTGAGGTCAAGG + Intergenic
951782591 3:26380844-26380866 GGGGAGATCCAATGACTTGAGGG + Intergenic
951797201 3:26552920-26552942 GGGGAGAGGCATTGTGGATATGG - Intergenic
952286514 3:31974723-31974745 GGGGAGATACTATGAGGAAAGGG + Intronic
952707532 3:36394425-36394447 GGGGAAAGCCAGGGAGGAGGAGG + Intronic
952715366 3:36474508-36474530 TGGCAGAGGCAATGAGGAGAAGG + Intronic
952957084 3:38564088-38564110 GGCTAGAGCCACTGAGCAGAAGG - Intronic
953256578 3:41296660-41296682 GGGAAGAGCAAATGAGCAGAGGG + Intronic
953636586 3:44670051-44670073 GGGAAGAGCCAGGGAGGAAAAGG + Intergenic
954655305 3:52190875-52190897 GGGCAGGGCCAGTAAGGAGAAGG - Intergenic
954672677 3:52299123-52299145 GGGGAGAGGAAATGGGGAGGGGG + Intergenic
954707832 3:52490454-52490476 GGGAACAGCCAGTGATGAGAAGG + Intronic
954865478 3:53725575-53725597 GGGGAGAGGCAGTGAGGCAATGG - Intronic
954932506 3:54296301-54296323 GGAGAGAGAAAAGGAGGAGAAGG - Intronic
955040941 3:55317273-55317295 GGTGGTAGCCAAAGAGGAGAAGG - Intergenic
955223331 3:57040965-57040987 GGGGAGTGCCTGAGAGGAGATGG - Intronic
955506845 3:59640846-59640868 GGGAGGAGCCACTGAGGAGGCGG + Intergenic
955978094 3:64497516-64497538 GGGGAGAGTCAAGGAGCAGCTGG - Intergenic
956219335 3:66884815-66884837 GGGGAGAGGGAAGGAGGGGAAGG + Intergenic
956849752 3:73217925-73217947 AGAGAGAGACAAAGAGGAGACGG - Intergenic
957058689 3:75463755-75463777 GGAGAGGGGCAATGAGGAGAAGG - Intergenic
957640774 3:82850353-82850375 GGAGAATGACAATGAGGAGAAGG - Intergenic
958069546 3:88592729-88592751 GGGGAGAGACAGTGAGAAGCTGG + Intergenic
958761331 3:98311894-98311916 GGGTACATCCAATGAGGACATGG + Intergenic
959092330 3:101917157-101917179 AGGGAGCTCCAAGGAGGAGAAGG + Intergenic
959971768 3:112417551-112417573 GAGGGGAGCCACTGAGGAAAAGG + Intergenic
961251229 3:125507450-125507472 GGGGAGAGAGAAAAAGGAGAAGG + Intronic
961635807 3:128331551-128331573 GGGGAGATGCATGGAGGAGAAGG - Intronic
963982176 3:151550954-151550976 AGTGAGAGCCAATGGGGACAAGG - Intergenic
964673673 3:159254676-159254698 GGGGAGATAGAAAGAGGAGAGGG - Intronic
964709870 3:159660330-159660352 GGGAAAAGACAATGAGGAAAAGG - Intronic
966156501 3:176922375-176922397 AGGAAGATCCAAGGAGGAGAGGG - Intergenic
968074873 3:195810704-195810726 GGGAAGCGACAAGGAGGAGAGGG - Intronic
968492473 4:897544-897566 GAGGAGAGCCAAGGACGTGAGGG + Intronic
969248459 4:5951898-5951920 GGGAAGAGCAGAGGAGGAGAGGG - Intronic
970107986 4:12606634-12606656 GGAAAGAGCCATTTAGGAGAGGG - Intergenic
971344159 4:25797043-25797065 GTGGAGAGAGAAAGAGGAGAGGG + Intronic
972127713 4:35790122-35790144 GAGGAGAGCAGATGAGGGGAGGG + Intergenic
973042798 4:45494106-45494128 GGGTGGAGGAAATGAGGAGATGG - Intergenic
975658171 4:76662291-76662313 GGTGAGAGCCATTAAGGAAATGG - Intronic
975816054 4:78217861-78217883 GGGGAGGGCAAGAGAGGAGAGGG - Intronic
975816071 4:78217908-78217930 GGGGAGGGCAAGAGAGGAGAGGG - Intronic
976107929 4:81639578-81639600 GGGGATAGGCCAGGAGGAGAGGG + Intronic
977851664 4:101837898-101837920 GGGGAGAGAGAAGGGGGAGAGGG - Intronic
978541725 4:109823213-109823235 GGGCAGAGCCAAAGTGGAAAGGG + Intronic
981205609 4:142036044-142036066 GGGGAGAGGGAAGGAGGGGAGGG - Intronic
982266420 4:153542300-153542322 AGGGAGAGCCATTCAAGAGAGGG + Intronic
984574440 4:181430859-181430881 AGAGAGAGACAAAGAGGAGAGGG - Intergenic
986710858 5:10486962-10486984 AGGGAGGGCCAAGGAGGAGCAGG + Intergenic
986828479 5:11548282-11548304 GAAGAGAGACAATGAGGAGGGGG + Intronic
987170277 5:15249102-15249124 GTGGAGATCCACTAAGGAGAAGG - Intergenic
987838829 5:23196760-23196782 GGGGGGAGACAATGAGAAGTTGG + Intergenic
988796114 5:34655376-34655398 AGGCAGAGCTAACGAGGAGAAGG + Intergenic
991012848 5:61901815-61901837 GGGGCGAGGAAATGAGAAGAGGG - Intergenic
991166216 5:63567319-63567341 GGGTAGAGGGAAGGAGGAGATGG - Intergenic
992533264 5:77672315-77672337 GCTGAGAGCCAAACAGGAGATGG - Intergenic
992616983 5:78554449-78554471 GAAGAGAGCCAATAAAGAGATGG - Intronic
993480339 5:88416691-88416713 GGGGAGAGAGACTGGGGAGAGGG + Intergenic
996823245 5:127653897-127653919 GGGTAGAGACAATCAGGAGGTGG - Intronic
997294380 5:132760653-132760675 GGGGAGAGCCACTGAAGATGAGG + Intronic
997368647 5:133342007-133342029 TGCCAGAGCCAGTGAGGAGATGG - Intronic
997462996 5:134067664-134067686 GGGGAGGGCGAGGGAGGAGAGGG + Intergenic
998796186 5:145821672-145821694 AGGGAGGGCCAATGGGCAGAGGG - Intronic
999460911 5:151757286-151757308 GGGGGGTGGCAATGAGGAAAAGG - Intronic
999636570 5:153629198-153629220 GGGAAGAGGAAATGAGGAGGAGG - Intronic
1000165586 5:158645328-158645350 GGGGAGAGGCGATGAAGAAAAGG + Intergenic
1000210623 5:159103927-159103949 TGGGATAGCCAAGGAGCAGAAGG - Intergenic
1000343545 5:160295636-160295658 GAGGACAGACAAGGAGGAGAAGG + Intronic
1001055329 5:168444702-168444724 GTAGAGAACCCATGAGGAGAGGG - Intronic
1001127464 5:169033088-169033110 GGGGATAGCTAGGGAGGAGATGG - Intronic
1001268205 5:170290545-170290567 GGAGAAAGGCAAAGAGGAGAAGG - Intronic
1001335110 5:170790419-170790441 GGGGAGGAGCAAGGAGGAGAAGG - Intronic
1001519691 5:172382146-172382168 GGTGAGTGCAAAGGAGGAGAGGG + Intronic
1002914957 6:1521605-1521627 GTGGAAAGCCAATGATAAGAGGG - Intergenic
1003007425 6:2394564-2394586 GGCCAGGGCCAATGGGGAGAAGG + Intergenic
1003643055 6:7891742-7891764 GTGGAGAGCCAAGGCAGAGACGG + Intronic
1003714919 6:8635541-8635563 GTGGACAGCAAATGAGGGGAGGG - Intergenic
1004741497 6:18465494-18465516 GGGGAAACCTGATGAGGAGAAGG + Exonic
1004970761 6:20907696-20907718 CGGGAGGGCCAATGGGGAGTTGG + Intronic
1005503643 6:26451375-26451397 GGGCAGAGTCAATGTGGGGAGGG + Intronic
1006781767 6:36637080-36637102 GGGGAGAGGCAGAGAGCAGAAGG + Intergenic
1006840171 6:37023334-37023356 GGGGAAAGAAAAAGAGGAGAGGG - Intronic
1006894380 6:37457728-37457750 TGGGAGAGCCAAGGAGGAAGGGG + Intronic
1007282033 6:40720002-40720024 GGGGAGAGAGAATGAAGAGGTGG + Intergenic
1008385379 6:50883336-50883358 GTGGAAAGACAGTGAGGAGAAGG + Intergenic
1008810925 6:55497905-55497927 GGAGGGAGACAATGAGGGGAAGG + Intronic
1009956416 6:70460200-70460222 GGGGAGAGGGAACGAGGAAATGG - Intronic
1010040620 6:71378652-71378674 GGGGAGAGGCACTGTGGAGATGG + Intergenic
1010379631 6:75209278-75209300 TGGGAGAACGAGTGAGGAGAAGG + Intergenic
1011560053 6:88605051-88605073 GAGCAGAGTGAATGAGGAGAAGG + Intergenic
1011919360 6:92552232-92552254 GGGGAGAGGAAATGAGGGAAGGG + Intergenic
1012387120 6:98695194-98695216 GGGGAGAACCAAAAAAGAGATGG + Intergenic
1012528433 6:100205155-100205177 GGAGAGAGAAAAAGAGGAGATGG + Intergenic
1013021960 6:106229463-106229485 GGAGAGAGACAGAGAGGAGAGGG + Intronic
1013410911 6:109882251-109882273 GGGAAGAACAAAGGAGGAGAGGG + Intergenic
1014298298 6:119648174-119648196 GGGGAGGGCAAAGGAGGGGAGGG + Intergenic
1014503494 6:122223978-122224000 GGTGAAAGCCAATGAGAAAAAGG + Intergenic
1014837325 6:126174145-126174167 GAGGATAGCCTATGAGGAGTGGG - Intergenic
1015365327 6:132391127-132391149 GGGGAGAGGCAAGGAAGAGTAGG + Intronic
1016370238 6:143366151-143366173 GAGGAGAGTCCCTGAGGAGAAGG - Intergenic
1017336327 6:153264768-153264790 GAGGAGAGACACAGAGGAGAAGG + Intergenic
1017770053 6:157638074-157638096 GGGGAGAGGGAGGGAGGAGAGGG + Intronic
1017984239 6:159428663-159428685 GGGGAGCATCAATGAGAAGAAGG + Intergenic
1018441234 6:163815284-163815306 CTGCAGAGGCAATGAGGAGAGGG + Intergenic
1018560794 6:165099249-165099271 GGGGAGGGGAAAGGAGGAGATGG - Intergenic
1018842783 6:167530448-167530470 GGAGAGAGACAATGTGGAAATGG + Intergenic
1019346187 7:531830-531852 GGGGTGAGACAGAGAGGAGAGGG + Intergenic
1019796257 7:3050910-3050932 GGGAAGAAACAATGATGAGAAGG + Intergenic
1020015748 7:4830531-4830553 CGGGAGAGCAAGGGAGGAGAAGG + Intronic
1020272748 7:6607015-6607037 GGGGAGAACCCATGGGGAGTTGG + Intronic
1021023742 7:15638622-15638644 GGAGAGAGAGAAGGAGGAGAGGG - Intronic
1021205674 7:17777019-17777041 GGGGATAGGGAATGAGGAGGGGG - Intergenic
1021914655 7:25419377-25419399 GGTGAGAGCTAATGAGGATGGGG - Intergenic
1021980846 7:26054052-26054074 GGGGAGAGGCAATTAGGAATGGG - Intergenic
1022572145 7:31465336-31465358 TGGGAAAGCCACTGAGGAAATGG + Intergenic
1024053690 7:45646147-45646169 GGGCAGTGCCAATGGGGACAGGG + Intronic
1024068243 7:45762769-45762791 GGGAAGAGCCTATTAGGAAATGG - Intergenic
1024263658 7:47590242-47590264 GGGGAGAGACAGTGAGGGGCAGG - Intergenic
1024574948 7:50755694-50755716 GAGCCGAGCCAAGGAGGAGAGGG + Intronic
1024577666 7:50777919-50777941 GGGGAGAGGGACTGAGGGGAGGG + Intronic
1024919925 7:54545486-54545508 GGAGAGAGGGAGTGAGGAGAGGG + Intronic
1024944771 7:54797718-54797740 GGGGAGAGCCAATCAAAAGGAGG + Intergenic
1026106411 7:67424395-67424417 GGGGAGAGGCACCTAGGAGATGG - Intergenic
1030196857 7:106860910-106860932 GAGGAGAGAGAATGAGGGGAGGG + Intergenic
1031648173 7:124253114-124253136 GGGGAGAGGCACAGGGGAGAAGG - Intergenic
1033273866 7:139956645-139956667 GGGCGGAGCCAGTGAGGTGACGG - Intronic
1034073535 7:148210312-148210334 GGGGACAGCAAATGAGATGAGGG - Intronic
1034121664 7:148633510-148633532 GGAGAGAGATAATGAGGATAAGG + Intergenic
1034166293 7:149027913-149027935 AGGGAGAGCCACTGGAGAGAAGG - Intronic
1034172641 7:149074471-149074493 GGGGAGAGCCCTTCAGGAAATGG - Exonic
1034399724 7:150854294-150854316 GGGGAGAGCCCTCGGGGAGAGGG + Intronic
1034719923 7:153282186-153282208 GGGAGGAGCCAGTGAGGAGTAGG - Intergenic
1035280790 7:157776730-157776752 GAGGAGAGAGCATGAGGAGAGGG - Intronic
1035454186 7:158998062-158998084 GGGGGGTCCCACTGAGGAGAGGG - Intergenic
1035454220 7:158998164-158998186 GGGGGGTCCCACTGAGGAGAGGG - Intergenic
1035454237 7:158998214-158998236 GGGGGGTCCCACTGAGGAGAGGG - Intergenic
1035454254 7:158998265-158998287 GGGGGGTCCCACTGAGGAGAGGG - Intergenic
1035454271 7:158998316-158998338 GGGGGGTCCCACTGAGGAGAGGG - Intergenic
1035454345 7:158998522-158998544 GGGGGGTCCCACTGAGGAGAGGG - Intergenic
1035454378 7:158998625-158998647 GGGGGGTCCCACTGAGGAGAGGG - Intergenic
1035567339 8:650286-650308 GGGGAGACCCAGCGAGGACAGGG - Intronic
1035644100 8:1205297-1205319 GGGGATAGCCCCTGAGGCGACGG + Intergenic
1035648418 8:1246443-1246465 GAGGAGACACACTGAGGAGAAGG - Intergenic
1038311569 8:26449505-26449527 GGGGAGAGGAAAGGGGGAGAGGG + Intronic
1039781690 8:40792651-40792673 GGGGAGGGGAGATGAGGAGAGGG + Intronic
1040787395 8:51181613-51181635 TGGGAGAGCCAGAAAGGAGATGG - Intergenic
1040972702 8:53154365-53154387 GGGGAGAGCCAGGGAGCAGGGGG + Intergenic
1041263047 8:56038240-56038262 GGGCAGATCCAGTGAGGAGGAGG + Intergenic
1041458682 8:58087598-58087620 CCGATGAGCCAATGAGGAGATGG - Intronic
1041565160 8:59268850-59268872 GGAAAGAGCCAGTGAGTAGAAGG - Intergenic
1041682610 8:60608529-60608551 GGAGAGAGAGAAGGAGGAGAAGG - Intronic
1043521291 8:81048334-81048356 GGGTAGAGTAAATGAAGAGATGG - Intronic
1044229046 8:89754194-89754216 GGGGAGAGGCATTGATTAGAAGG - Intergenic
1044293660 8:90502508-90502530 GTGAAGATGCAATGAGGAGATGG - Intergenic
1044878899 8:96701889-96701911 GGTCAGAGCCAATTAGTAGAAGG - Intronic
1045239111 8:100383121-100383143 GGAGAGAGACAAAGAGGACATGG + Intronic
1045342764 8:101269042-101269064 GGGGTTAGGCAATGAGAAGAGGG - Intergenic
1046637672 8:116690103-116690125 GCGGAGAGCCAGTATGGAGAAGG - Intronic
1047314515 8:123720188-123720210 GGGAAGAGCCAGGGAGCAGAGGG + Intronic
1048271409 8:133031118-133031140 GGGCTGAGAGAATGAGGAGATGG - Intronic
1048591646 8:135826117-135826139 GGGCCAAGCCAATGAAGAGATGG - Intergenic
1050021149 9:1285775-1285797 GAGAAGGGCCAAGGAGGAGAGGG - Intergenic
1050080754 9:1913277-1913299 GGGGAGGGCCAATGATAAGCAGG + Intergenic
1050094656 9:2051461-2051483 GTGGAGCGGAAATGAGGAGATGG - Intronic
1051168866 9:14297250-14297272 GGGCAGCGCCAATGTGGAGTTGG - Intronic
1051193956 9:14542981-14543003 GGGGAAAGCAGAGGAGGAGATGG - Intergenic
1051362079 9:16289890-16289912 GGGGAGAGCTACTGAGGACCAGG + Intergenic
1051753579 9:20370403-20370425 AGGGAGACCCAAGGAGAAGAAGG - Intronic
1052975206 9:34405202-34405224 AGGGACAGCCCATGAGGTGAAGG + Intronic
1053008940 9:34622570-34622592 GGGGAGAACCAATGCAGAGATGG - Intronic
1054981239 9:71209346-71209368 GGAGAGAGGCAATGAGGGGGTGG + Intronic
1055316560 9:75039867-75039889 GGGGAGGGCAAGGGAGGAGAGGG - Intergenic
1055998786 9:82192481-82192503 GGGAAGAATCACTGAGGAGAAGG - Intergenic
1056710553 9:88989522-88989544 GGGGAGACCCACTGAGGACAGGG + Intergenic
1057031988 9:91783094-91783116 ATGGAGGGACAATGAGGAGATGG - Intronic
1057444616 9:95104845-95104867 GGGGAGGGGCAGTGGGGAGATGG - Intronic
1058754989 9:108075862-108075884 GGGGACAGAAAAAGAGGAGATGG - Intergenic
1059023618 9:110601752-110601774 GGAGAGAACCATTGAGGAAAAGG - Intergenic
1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG + Intronic
1060979773 9:127785570-127785592 GGGAAGAGCCGACTAGGAGACGG - Intergenic
1061357642 9:130118660-130118682 GGGGAGAGAAAAGGAGGAGACGG - Intronic
1061726017 9:132582486-132582508 GGGGAGAGCAAAGGGGGAGACGG - Exonic
1062223411 9:135433544-135433566 GTGGAGAGCAGATGAGGATATGG + Intergenic
1062477950 9:136738653-136738675 GGGGAGAGCCACAGAGGAGCAGG - Intronic
1062556199 9:137114387-137114409 GGGGAGGGCGGATGAGGCGAGGG + Intronic
1062725423 9:138070753-138070775 GGGGACAGACAATGTGGGGAAGG - Intronic
1185708296 X:2281811-2281833 AGGGAGAGAGAAGGAGGAGAGGG + Intronic
1186031733 X:5376060-5376082 GGGGACAGTCAGAGAGGAGATGG + Intergenic
1186697829 X:12055978-12056000 GGGGAGAAAAAATGAGGAGGAGG - Intergenic
1187421370 X:19136835-19136857 GGGGAGAGAAATTCAGGAGAAGG - Intergenic
1188002971 X:24999297-24999319 GGAGAGAGACAGTGAGGAGCAGG - Intergenic
1188214148 X:27457855-27457877 GTGGAAAGCGAGTGAGGAGAGGG - Intergenic
1190440576 X:50470995-50471017 GGGGAGAGACAAAAAGGGGAGGG + Intergenic
1192211064 X:69128434-69128456 AGGGAGAGCAAATGAGGATTTGG + Intergenic
1192800094 X:74457523-74457545 GGGGAAAGGCAATGACAAGAGGG - Intronic
1193230645 X:79041528-79041550 GGCAAGAGAAAATGAGGAGAAGG + Intergenic
1194408859 X:93532407-93532429 GGCAAGAGAGAATGAGGAGAGGG - Intergenic
1195010899 X:100731652-100731674 GAGGGGAGCCGAAGAGGAGAGGG + Intronic
1195156747 X:102130924-102130946 GTGCAGAGCCTATGTGGAGAGGG - Intergenic
1195721719 X:107874797-107874819 GGGGAGGGGAAAGGAGGAGATGG + Intronic
1196963756 X:121032677-121032699 GTGGACAGCCAATGAGGAAATGG - Intergenic
1198369790 X:135979313-135979335 TGGGAGCGCCAAAGAAGAGAAGG - Intergenic
1198700203 X:139388519-139388541 GGACAGAGCTAATGAGGACAAGG - Intergenic
1200138523 X:153886211-153886233 GGGGAGCGCCGGGGAGGAGAGGG + Intronic
1201306116 Y:12552031-12552053 GAGGAGAGCCAGAGAGGAGGGGG - Intergenic
1201451119 Y:14116119-14116141 GGAGAGAGGGAAGGAGGAGAGGG + Intergenic
1201576046 Y:15462187-15462209 GGGGGGAAACAATAAGGAGAAGG + Intergenic