ID: 1077001109

View in Genome Browser
Species Human (GRCh38)
Location 11:322757-322779
Sequence TCCCTGTGTTAAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 4, 2: 24, 3: 48, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077001106_1077001109 8 Left 1077001106 11:322726-322748 CCAAAAACAAAGGAAAATTTGTT 0: 1
1: 1
2: 8
3: 94
4: 938
Right 1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG 0: 1
1: 4
2: 24
3: 48
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077001109 Original CRISPR TCCCTGTGTTAAGGGAGTGC TGG Intronic
901198752 1:7454816-7454838 TCCCTGTGTTAAAGGAAGGTTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
908945639 1:69493047-69493069 TAGCTGGGTTAAGGGAGTGTAGG + Intergenic
909410710 1:75347660-75347682 TCCCAGGGCTAAGGGAGTGGTGG + Intronic
909742376 1:79045833-79045855 TCCTTATGATACGGGAGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911762275 1:101630130-101630152 TCCCTGAGTTCAGGGAATACAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918323293 1:183384938-183384960 TCCCAGTGTTTTGGGAGTCCAGG + Intronic
919425949 1:197430588-197430610 TCTCTGGGTTAAGAGAGTTCAGG - Intronic
923664979 1:235991759-235991781 TCCCTGTGGGCAGGGAGTTCAGG - Intronic
924680421 1:246225578-246225600 CACCTGTGTTAAGTGTGTGCTGG - Intronic
924697966 1:246419655-246419677 TGACTGTGATACGGGAGTGCTGG - Intronic
1064892331 10:20191527-20191549 CCTCTGTGTTAGTGGAGTGCAGG - Intronic
1067102373 10:43342738-43342760 GCCCAGGGTTAAGGGGGTGCAGG + Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1071353297 10:84767901-84767923 TCCTGGTGATACGGGAGTGCTGG - Intergenic
1073137026 10:101225796-101225818 GCCCTGTTTTCGGGGAGTGCAGG + Intergenic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1074262147 10:111864773-111864795 TCACTGTGTTAAGGGATTTATGG - Intergenic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1076289412 10:129332902-129332924 TCCCTGTGTGATGGAAGTGTTGG - Intergenic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077430357 11:2513144-2513166 ACCCTGTGTGATGTGAGTGCAGG + Intronic
1079101006 11:17542458-17542480 TCCCTGTGTGCAGGCAGGGCAGG - Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081665921 11:44917111-44917133 CCCCTGTGCTAAGGCCGTGCGGG + Intronic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1084423069 11:69070484-69070506 TCACTGTGATAGGTGAGTGCAGG + Exonic
1084538406 11:69772381-69772403 TCCCTGTGTTTAGGGAGCTTTGG - Exonic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088837134 11:113587263-113587285 TCCCTGTTTAAGGTGAGTGCAGG + Intergenic
1091545594 12:1499563-1499585 TCCCTGTGGACAGGGAGGGCTGG - Intergenic
1092355503 12:7791600-7791622 TCCCTTTGTTATGTGACTGCAGG + Intronic
1093815685 12:23543375-23543397 TTCCTGTTTTCAGGAAGTGCTGG - Exonic
1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG + Intronic
1094638655 12:32251673-32251695 TCCCTGTGTTAATGGAGTCTTGG + Intronic
1095536055 12:43248984-43249006 TCCATTTGTTAAGAGAGTGATGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097803509 12:63940477-63940499 GCCATGTGTTAAGGGGGTGGGGG + Intronic
1098291098 12:68957437-68957459 TCCCTGTCTTAAGAATGTGCTGG + Intronic
1101158045 12:101946181-101946203 CCTCTGTGTTAAGACAGTGCAGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1107521393 13:41185591-41185613 TCTCTGTGTTAAAGGTATGCAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108938005 13:55910277-55910299 TCCCATTGATATGGGAGTGCTGG - Intergenic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116885241 14:50214426-50214448 TGGCTGTGTTAAAGAAGTGCAGG - Intronic
1118647035 14:67850641-67850663 TTCCTATTTTACGGGAGTGCTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121320574 14:92989425-92989447 TCCCTGTCTTCAGGGACAGCAGG - Intronic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123752901 15:23372558-23372580 TCCCGGTGTTTTGGGATTGCAGG - Intergenic
1125079035 15:35655519-35655541 TGGCTGTGTTAAGGTAGTGGTGG + Intergenic
1126745114 15:51818024-51818046 TCCATGTGATACAGGAGTGCTGG - Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129523931 15:76202304-76202326 TCTCTGGGTTTAGGGATTGCTGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130427128 15:83812500-83812522 GCCCTGTATTAAGGGACGGCAGG + Intronic
1134875712 16:17696798-17696820 TCCTAGAGTTAAGGGAATGCCGG - Intergenic
1139959386 16:70709031-70709053 TCCCTGTGGCAAGAGAGGGCAGG - Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1141839533 16:86565938-86565960 TCCCGGTCTTCTGGGAGTGCGGG + Intergenic
1144202133 17:12951116-12951138 TCATTGTGAAAAGGGAGTGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1147610909 17:41801369-41801391 TCCCGGTGTGCAGGGTGTGCAGG - Intergenic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1151378177 17:73705967-73705989 TTCATGTCTTAAGGGAATGCTGG - Intergenic
1151513029 17:74573307-74573329 TCTCTGGGTCAAGGGAGAGCGGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152022289 17:77786519-77786541 TCCCTGTGTGAAGGGAGATGTGG - Intergenic
1152292674 17:79449100-79449122 TCTCTGTGGTAAGGGACTACAGG - Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1155023114 18:21914739-21914761 TCCCAGTGTTTAGGGAGGCCAGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160432432 18:78821023-78821045 TGCCTGTGTACAGGGGGTGCTGG - Intergenic
1160759395 19:775391-775413 TCCCTGGGGTCAGTGAGTGCTGG + Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1161749326 19:6083028-6083050 TCCCTGGGCTCAGGGAGTACGGG + Intronic
1161929529 19:7328344-7328366 TCCCAGTGTTAAGAAGGTGCTGG - Intergenic
1162408670 19:10491458-10491480 TTCCTGTCTTCAGGGAGTGGAGG - Intronic
1163045635 19:14639672-14639694 TCCCAGTGTGCAGGGATTGCAGG + Intronic
1163270093 19:16247876-16247898 TCGCTGTGTTCAGAGAGGGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165635259 19:37334822-37334844 TCCCTGTGTTACGGGGACGCCGG + Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166345424 19:42162384-42162406 TCCCAGTCTTAAGGCACTGCTGG - Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925246229 2:2385912-2385934 CACCTGTATTAAGGGAATGCTGG - Intergenic
926174274 2:10575095-10575117 TCCCTCTGTGACAGGAGTGCTGG - Intronic
926329090 2:11810189-11810211 TCCCTGTAATAAGGCAGTGAGGG + Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927432693 2:23040527-23040549 ACCCTGTGTAATGGGAGAGCCGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933031083 2:77329574-77329596 TCTCTGTGCAAAGGGAGTGCAGG - Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
937391972 2:121496790-121496812 TCCCTCTGTTAAGTGTGGGCAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938577209 2:132615853-132615875 TCCCTGTGTCAGGCAAGTGCAGG - Intronic
944080975 2:195787968-195787990 AGCCTGTATGAAGGGAGTGCTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168780198 20:482657-482679 TCCCTGTGTAAAGGTCTTGCTGG - Exonic
1170516833 20:17138657-17138679 TGACTGTGTTAAGGGAAGGCAGG + Intergenic
1171564256 20:26163631-26163653 TAGCTGTGATATGGGAGTGCTGG - Intergenic
1172009824 20:31840090-31840112 GCCCTGTGTGAAGGGAGAGATGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173987655 20:47274971-47274993 TTCCTGTGTGAAGGGAGTGAGGG + Intronic
1174159234 20:48538997-48539019 CCCCTGTGTTCATGGAATGCAGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176426774 21:6553130-6553152 GCCTTGGGTTAAGGGGGTGCGGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1176725034 21:10424562-10424584 GCTCTGTGTTAAGCCAGTGCTGG + Intergenic
1177787955 21:25692891-25692913 TCCCTGTTTTATGTGAGTGAAGG + Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1178928877 21:36799680-36799702 GGCCTGTGTTAACGAAGTGCTGG + Intronic
1178961777 21:37072801-37072823 TCCCTGTGGGAGGGGAGGGCAGG + Exonic
1179702265 21:43161452-43161474 GCCTTGGGTTAAGGGGGTGCGGG - Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1182519082 22:30875223-30875245 TCCCTCTGGAAGGGGAGTGCAGG - Intronic
1183716257 22:39535249-39535271 ACTCTTTGTTAAGGGATTGCTGG - Intergenic
1185399123 22:50606876-50606898 TCCCTGTGTCAAAGGAGGCCTGG - Intronic
949498238 3:4653965-4653987 TCACTGTGGTCACGGAGTGCTGG + Intronic
954403173 3:50330058-50330080 ACCCTGAGGTCAGGGAGTGCTGG - Exonic
955133431 3:56192604-56192626 TCTCTGTGTTTAGGGAGGCCTGG - Intronic
956635976 3:71365500-71365522 CCCCTGTGTTAAGATAGTGTAGG + Intronic
959247276 3:103888167-103888189 TCACTTTGTTATGGGAGTCCTGG + Intergenic
959700889 3:109298321-109298343 TCCCTGAGTTCAGGGATTACAGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
962608163 3:137050050-137050072 TATGTGTGTTAGGGGAGTGCAGG + Intergenic
964198507 3:154091267-154091289 TCCATGTGATAAGGGACTGAGGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
967036065 3:185649079-185649101 TCTCTGTTTTCAGGGAGTGGAGG + Intronic
967639511 3:191844538-191844560 ACCCTGTGTTCAGCGAGTGTTGG - Intergenic
968722483 4:2217876-2217898 TCTCTGGGTTTAGGGAGTGGAGG - Intronic
969465415 4:7353454-7353476 TTCCTGTGTGAAGGGTCTGCAGG + Intronic
970919666 4:21378700-21378722 CCCTTGTGTTAAGGGATAGCTGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
972694597 4:41433477-41433499 TCCCTGTGTTCAGTTGGTGCCGG + Intronic
972997664 4:44902114-44902136 TCCCTGAGTTAAGATAGTGCTGG - Intergenic
973966264 4:56165080-56165102 TCACTGTGTTAAGGAAGTTCAGG + Intergenic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
981181801 4:141754962-141754984 TCCCTTTCTGAAGGGAGTTCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
992056762 5:72997861-72997883 TCCATGTGTGAATGGAGTTCAGG + Intronic
992205537 5:74427147-74427169 TCCCTGAGGTTAGGGAGGGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
997257804 5:132442687-132442709 GCACTGTGTTAAGTGAGTGAAGG + Intronic
1000344538 5:160303926-160303948 AGCCTGTGCTAAGGGAGTGGAGG - Intronic
1002103536 5:176868972-176868994 TCCCTGTGACCAGGGAGTCCCGG - Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004036163 6:11926156-11926178 TTCCTGTCCTCAGGGAGTGCAGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1009543686 6:64999401-64999423 TCACTGTGATATGGAAGTGCTGG + Intronic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1013391364 6:109689441-109689463 ACCCTGTGTTCAGGGAGAGTAGG - Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1017994566 6:159520994-159521016 TCCCAGTGGGAAGGGAGTGACGG - Intergenic
1018123825 6:160662645-160662667 TCTGTGTGTGTAGGGAGTGCAGG - Intronic
1018442452 6:163825571-163825593 CCCCTGATTTAAGGGAGTGGAGG + Intergenic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1021939821 7:25668519-25668541 TCCCTGGGTGAAGGGAGGACAGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1023487036 7:40698417-40698439 ACCCTGTGTAACTGGAGTGCAGG + Intronic
1024264388 7:47595684-47595706 TCACTGTGATACAGGAGTGCTGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025273475 7:57550585-57550607 TAGCTGTGATATGGGAGTGCTGG + Intergenic
1031628781 7:124021270-124021292 TCCATCTGATAATGGAGTGCTGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033496880 7:141907805-141907827 TCCCAGTGTTAACCCAGTGCAGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1035339718 7:158152494-158152516 TCACAGTGATATGGGAGTGCTGG + Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041380459 8:57249261-57249283 TCCATGTGCTAAGGCTGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048260991 8:132944901-132944923 TCCCTGTGGGAAGAGGGTGCAGG + Intronic
1049581043 8:143411162-143411184 TCCCCTTGTTAAGTGAGGGCAGG + Intergenic
1052188008 9:25622067-25622089 TTCCTTTGTTAAGAGAGTGGAGG + Intergenic
1052323275 9:27191152-27191174 TCTCTGTGTTAAGAGTCTGCAGG - Intronic
1053290983 9:36879547-36879569 TCCCTGGGTGTGGGGAGTGCTGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055432325 9:76256818-76256840 TCACTGTGTTAAGGGAAGGATGG - Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057784875 9:98079637-98079659 TCTCTGTGGGATGGGAGTGCAGG - Intronic
1058789195 9:108424379-108424401 TCCCTGTGTAAATGGCATGCTGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060206129 9:121683893-121683915 GCCCTGTGTGATTGGAGTGCTGG + Intronic
1060421526 9:123472787-123472809 GCCCCGTGTTATGGGAATGCAGG - Intronic
1061425012 9:130493260-130493282 TCCCTGTGTACAGTGAGGGCTGG + Intronic
1061728420 9:132594586-132594608 CACCTGGGTGAAGGGAGTGCCGG + Exonic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190792677 X:53714734-53714756 TCTCTCTGTCAAGGCAGTGCTGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197720980 X:129744480-129744502 ATCCTGGGTTAAGGGAGCGCGGG + Intronic
1198933410 X:141882892-141882914 TCCCTGAGCTAAGGTAGTGTGGG + Intronic
1199791049 X:151155583-151155605 TTCTTGTCTAAAGGGAGTGCAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic