ID: 1077002029

View in Genome Browser
Species Human (GRCh38)
Location 11:328267-328289
Sequence GCCTCTGGGCAGTGGGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077002023_1077002029 -3 Left 1077002023 11:328247-328269 CCTCGTATGGCACGGGGCAGGCC No data
Right 1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG No data
1077002014_1077002029 12 Left 1077002014 11:328232-328254 CCTTCCCCAAATATGCCTCGTAT No data
Right 1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG No data
1077002018_1077002029 6 Left 1077002018 11:328238-328260 CCAAATATGCCTCGTATGGCACG No data
Right 1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG No data
1077002017_1077002029 7 Left 1077002017 11:328237-328259 CCCAAATATGCCTCGTATGGCAC No data
Right 1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG No data
1077002016_1077002029 8 Left 1077002016 11:328236-328258 CCCCAAATATGCCTCGTATGGCA No data
Right 1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077002029 Original CRISPR GCCTCTGGGCAGTGGGCAGC GGG Intergenic
No off target data available for this crispr