ID: 1077005104

View in Genome Browser
Species Human (GRCh38)
Location 11:351313-351335
Sequence AGGGTCCCTTTTAAGATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077005104_1077005106 -6 Left 1077005104 11:351313-351335 CCCTAAATCTTAAAAGGGACCCT No data
Right 1077005106 11:351330-351352 GACCCTAACCAACCCTCCTAAGG No data
1077005104_1077005117 16 Left 1077005104 11:351313-351335 CCCTAAATCTTAAAAGGGACCCT No data
Right 1077005117 11:351352-351374 GTGGGTCTCTAACCCAAGGTGGG No data
1077005104_1077005116 15 Left 1077005104 11:351313-351335 CCCTAAATCTTAAAAGGGACCCT No data
Right 1077005116 11:351351-351373 GGTGGGTCTCTAACCCAAGGTGG No data
1077005104_1077005115 12 Left 1077005104 11:351313-351335 CCCTAAATCTTAAAAGGGACCCT No data
Right 1077005115 11:351348-351370 TAAGGTGGGTCTCTAACCCAAGG No data
1077005104_1077005110 -2 Left 1077005104 11:351313-351335 CCCTAAATCTTAAAAGGGACCCT No data
Right 1077005110 11:351334-351356 CTAACCAACCCTCCTAAGGTGGG No data
1077005104_1077005109 -3 Left 1077005104 11:351313-351335 CCCTAAATCTTAAAAGGGACCCT No data
Right 1077005109 11:351333-351355 CCTAACCAACCCTCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077005104 Original CRISPR AGGGTCCCTTTTAAGATTTA GGG (reversed) Intergenic
No off target data available for this crispr