ID: 1077005436

View in Genome Browser
Species Human (GRCh38)
Location 11:353229-353251
Sequence CACCAATAGCAGCTCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077005436_1077005443 -10 Left 1077005436 11:353229-353251 CCCAGCCCGAGCTGCTATTGGTG No data
Right 1077005443 11:353242-353264 GCTATTGGTGGGCGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077005436 Original CRISPR CACCAATAGCAGCTCGGGCT GGG (reversed) Intergenic
No off target data available for this crispr