ID: 1077006676

View in Genome Browser
Species Human (GRCh38)
Location 11:361231-361253
Sequence CCTTCCACACAGGCCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077006676_1077006683 2 Left 1077006676 11:361231-361253 CCTTCTTTGGCCTGTGTGGAAGG No data
Right 1077006683 11:361256-361278 GGAGGATCTGGAAGAAGGACAGG No data
1077006676_1077006685 29 Left 1077006676 11:361231-361253 CCTTCTTTGGCCTGTGTGGAAGG No data
Right 1077006685 11:361283-361305 TGCTGTAAAAAATAATCAGACGG No data
1077006676_1077006684 3 Left 1077006676 11:361231-361253 CCTTCTTTGGCCTGTGTGGAAGG No data
Right 1077006684 11:361257-361279 GAGGATCTGGAAGAAGGACAGGG No data
1077006676_1077006682 -3 Left 1077006676 11:361231-361253 CCTTCTTTGGCCTGTGTGGAAGG No data
Right 1077006682 11:361251-361273 AGGCAGGAGGATCTGGAAGAAGG No data
1077006676_1077006681 -10 Left 1077006676 11:361231-361253 CCTTCTTTGGCCTGTGTGGAAGG No data
Right 1077006681 11:361244-361266 GTGTGGAAGGCAGGAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077006676 Original CRISPR CCTTCCACACAGGCCAAAGA AGG (reversed) Intergenic