ID: 1077008620

View in Genome Browser
Species Human (GRCh38)
Location 11:370308-370330
Sequence ACCCTGCTGAGGCTTCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008615_1077008620 0 Left 1077008615 11:370285-370307 CCTGGGGAAGTCTCTGCCCCTAG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1077008620 11:370308-370330 ACCCTGCTGAGGCTTCCAAGAGG 0: 1
1: 1
2: 3
3: 21
4: 155
1077008609_1077008620 27 Left 1077008609 11:370258-370280 CCGGTAGTGAGGGGCTGACGGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1077008620 11:370308-370330 ACCCTGCTGAGGCTTCCAAGAGG 0: 1
1: 1
2: 3
3: 21
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008620 Original CRISPR ACCCTGCTGAGGCTTCCAAG AGG Intronic