ID: 1077008655

View in Genome Browser
Species Human (GRCh38)
Location 11:370423-370445
Sequence GGGAAGCGTCCCAGCTGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008655_1077008665 15 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008655_1077008668 18 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157
1077008655_1077008666 16 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008666 11:370462-370484 GTGAACTGTGCCAGTGTTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1077008655_1077008670 30 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008655_1077008661 -6 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008661 11:370440-370462 CTTCCCGGCGGGGGCGCCTTCGG 0: 1
1: 0
2: 0
3: 11
4: 73
1077008655_1077008667 17 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008655 Original CRISPR GGGAAGCGTCCCAGCTGCAC CGG (reversed) Intronic
901279810 1:8025790-8025812 GGGATACGTCCCCGCAGCACCGG - Intronic
901423534 1:9166635-9166657 GGGCAGCCTCCCTGCTGCAGGGG - Intergenic
902439644 1:16421142-16421164 GGGAAGCCTCCCAGGTGTTCAGG + Intronic
904484319 1:30814814-30814836 GGGAAGCTTCCGAGCTTGACTGG - Intergenic
904593749 1:31630013-31630035 GTGAGGGGTCCCAGCTGCAGAGG + Exonic
907403461 1:54239794-54239816 GGGAAGCTGCTCAGCTGCAGGGG - Intronic
909898932 1:81109122-81109144 GGGTAGAGCTCCAGCTGCACTGG + Intergenic
911360757 1:96873371-96873393 TGAAAGTGTCCCTGCTGCACAGG - Intergenic
913324691 1:117616507-117616529 GGGAAGAGCCACAGGTGCACGGG + Intronic
915142869 1:153777806-153777828 GGGAAGATTGCCAGCAGCACAGG + Exonic
919843101 1:201623377-201623399 CGGAAGCCTCCAAGCTGCCCAGG + Intronic
919931434 1:202223820-202223842 GGCAAGTGTCCCAGCCCCACAGG + Intronic
919931455 1:202223876-202223898 GGCAAGTGTCCCAGCCCCACAGG - Intronic
922455026 1:225767716-225767738 GGGAAGCCTCACAGCTGTTCTGG - Intergenic
924648490 1:245902233-245902255 GGGCAGCCTCCCTGGTGCACTGG - Intronic
1062953937 10:1527825-1527847 GGAGAGGGGCCCAGCTGCACGGG + Intronic
1063124926 10:3129226-3129248 GGGAAGTCTTCCAGATGCACAGG - Intronic
1064376453 10:14800876-14800898 GGAAGGTGTCCCAGCTGCTCAGG - Intergenic
1065385112 10:25126349-25126371 GGGAATAGTCCTAGCTACACAGG - Intergenic
1066192811 10:33071310-33071332 GGTAAGGGTCCCAGCTACAGGGG - Intergenic
1069694916 10:70379668-70379690 GGGAAGCCACCAAGCTGCCCAGG + Intronic
1069942604 10:71965411-71965433 GGGAAGGGTCCCTGCTTCCCTGG - Intronic
1072625246 10:97107184-97107206 GGGAAGTACCCCAGCTGCAGGGG + Intronic
1074310686 10:112320513-112320535 TGGTAGCGTCCCAGCTACTCTGG - Intergenic
1076070359 10:127483830-127483852 GGGCAGCCTCCAGGCTGCACTGG - Intergenic
1076684164 10:132189564-132189586 GGAGTGCGTCCGAGCTGCACTGG + Intronic
1077008655 11:370423-370445 GGGAAGCGTCCCAGCTGCACCGG - Intronic
1080887196 11:36377482-36377504 AGGCAGGGTCCCAGCTGCCCGGG - Intronic
1082996653 11:59260946-59260968 GGGCAGAGTCCAAGCTGCAAGGG + Intergenic
1083594392 11:63912010-63912032 AGGAAGCGGCCCTGCTGCAGTGG + Exonic
1083827230 11:65210669-65210691 GTGAAGCTTCCCAGCTTCAAGGG + Intronic
1083921044 11:65781435-65781457 GAAAAGCGCCCCAGCTGAACCGG + Intergenic
1084010154 11:66343543-66343565 TGGAAGCCTCCCTGCTGCATCGG - Intronic
1084316676 11:68349714-68349736 GGGAGGTGGCCCAGCTCCACTGG + Intronic
1089126735 11:116181519-116181541 GGGGAGCGTTTCAGCTGGACAGG - Intergenic
1090840834 11:130486574-130486596 GGGCAGCGTCCCATCTGCAGGGG + Intergenic
1091755724 12:3050203-3050225 GGGAAGTCCCCCAACTGCACGGG + Intergenic
1100748154 12:97667989-97668011 AGGAAGCCTCCCAGCTGCTCAGG - Intergenic
1103433136 12:120904503-120904525 GGGAGGCGGCCCAACTGCTCTGG - Intergenic
1103700883 12:122848221-122848243 GGGAAGGAGCCAAGCTGCACAGG - Intronic
1106177982 13:27347554-27347576 GGGATGGGTCACAGCTGCAGAGG + Intergenic
1110968792 13:81734720-81734742 GGGAAGCAACCCAGATGCCCCGG - Intergenic
1111919898 13:94399132-94399154 GGGAAGCATCCCTGCTTCAGAGG + Intronic
1117994652 14:61467387-61467409 GGGAAGCATCAGAGCTGGACAGG - Intronic
1118464427 14:66017728-66017750 AGGAAGCGTTCCTGGTGCACTGG + Intergenic
1120853419 14:89191324-89191346 GCGCAGCGTCCCAGCTGCCCTGG + Intronic
1121036061 14:90704589-90704611 GGGAAGGCTCCCAGCGGCACAGG + Intronic
1128556503 15:68635405-68635427 GGGAAGCATCCATGCTCCACTGG - Intronic
1132623985 16:881405-881427 GCTGAGTGTCCCAGCTGCACGGG - Intronic
1132927249 16:2437300-2437322 GGGCAGAGTGCCAGCTGCAGAGG + Exonic
1133325660 16:4940763-4940785 GTGCAGCCTCCCAGCTGCTCAGG + Intronic
1133972986 16:10580465-10580487 GGGTCGCGTCCCTGCTGCCCGGG + Intronic
1134843034 16:17416552-17416574 TGGCAGCCTCCTAGCTGCACAGG - Intronic
1135073972 16:19377362-19377384 AGGAGGCCTCCCAGCTGCTCAGG + Intergenic
1140253828 16:73318011-73318033 GGGAATCCTCCCAGCTACAGAGG + Intergenic
1141827173 16:86488696-86488718 GGGAAACACCCCAGGTGCACAGG + Intergenic
1143885171 17:10059938-10059960 GGGAAAGGGCCCAGCTGCCCTGG - Intronic
1145230845 17:21172249-21172271 GAGGAGCGGCCCAGCTGCACAGG + Intronic
1148688545 17:49513817-49513839 GGCAAGCATCCCATCTCCACGGG - Exonic
1151745252 17:76008456-76008478 GGGAGGAGTCCGAGCTGCAGAGG - Exonic
1151808700 17:76423006-76423028 GGGAAGTGTCCCTGCTGACCTGG + Intronic
1154492983 18:14935248-14935270 GGAAAGTGTCCTAGCAGCACAGG - Intergenic
1157675516 18:49565740-49565762 GGGCAGCAGCCCAGCTCCACTGG + Intronic
1160238040 18:77101228-77101250 GGAAAGGGTGCCAGCTGCCCTGG - Intronic
1161448664 19:4332149-4332171 GGGAAGAGTCCCTGCTTCAAAGG + Intronic
1162020086 19:7864351-7864373 GGGAAGCCTCCCTGCTTCTCTGG + Intronic
1162733431 19:12732573-12732595 GGAAATAGTCCCAGCAGCACAGG - Intronic
1163725275 19:18919820-18919842 GGGATGCAGCCGAGCTGCACGGG - Exonic
1164486052 19:28656740-28656762 TAGAAGCCTCCCAGCTGCAATGG + Intergenic
1164692840 19:30223623-30223645 CGGACGCGTCGCAGCTGCCCTGG - Intergenic
1166173732 19:41050654-41050676 AGGAAGGGTCGCACCTGCACAGG + Intergenic
1167383744 19:49152448-49152470 GGGAAGCGTCCAGGGTGCAGGGG - Intronic
1168417106 19:56176089-56176111 GGGGCGGATCCCAGCTGCACCGG + Intronic
1168417163 19:56176289-56176311 GGGGCGGATCCCAGCTGCACCGG + Intronic
1168417179 19:56176339-56176361 GGGGCGGATCCCAGCTGCACCGG + Intronic
1168417195 19:56176389-56176411 GGGGCGGATCCCAGCTGCACCGG + Intronic
1168417226 19:56176489-56176511 GGGGCGGATCCCAGCTGCACGGG + Intronic
933770522 2:85741335-85741357 GAGAAGCGACCCAGCCACACAGG + Intergenic
935756083 2:106276960-106276982 GGGAAGCTTCCCAGCTGTAATGG - Intergenic
935933635 2:108157089-108157111 CGGATTCGTCCCAGCTACACGGG + Intergenic
935972499 2:108543916-108543938 AGGAAGAGTCCCAGCTACTCAGG + Intronic
936113407 2:109683458-109683480 AGGAAGTTTCCCAGCTGCAATGG + Intergenic
937987569 2:127645211-127645233 GGCAATAATCCCAGCTGCACAGG + Intronic
938244233 2:129765005-129765027 GAGAAGCATCCCAGCTGGAGTGG - Intergenic
938402664 2:131005768-131005790 GGGAAGCTGCCCAGCACCACGGG - Intronic
939574261 2:143877242-143877264 TGGAAGGGTGCCAGCTGCCCAGG - Intergenic
948693991 2:239723563-239723585 TGGATGAGTCCCAGCTGCCCTGG + Intergenic
948805710 2:240452815-240452837 GGGCAGCGCCGCAGCCGCACTGG - Intronic
948948888 2:241236314-241236336 TGGAAGGGTCTCAGCTGCAGGGG - Intronic
1168803886 20:661901-661923 GGGAAGTGCCCCTGCTGCAGGGG + Exonic
1170562382 20:17569334-17569356 GGGAGGCGTCCCCGCTGCCGCGG + Intergenic
1170695192 20:18651645-18651667 GGGAGGGGCCCAAGCTGCACAGG - Intronic
1172658373 20:36550222-36550244 GGCAGGCGTCCCAGCAGCTCAGG + Exonic
1173733784 20:45345793-45345815 GGGAATGCTCCCAGCTGGACAGG + Intronic
1175581040 20:60099857-60099879 GTGAAGGGTCCCAGGTGCTCAGG + Intergenic
1175875407 20:62227260-62227282 GGGCTGGGTCCCAGCTGCCCTGG - Intergenic
1179089640 21:38252802-38252824 GGGAAGACTCCCAGCAGCACTGG - Intronic
1179156846 21:38858529-38858551 GGGAAGCCTCCCAGATGCCAAGG + Intergenic
1179905691 21:44421808-44421830 GGTCAGAGTCCCAGCTGCTCAGG + Intronic
1181756636 22:25028958-25028980 GAGCAGCGTCCAAGCTGGACAGG + Exonic
1184443517 22:44533776-44533798 GGGTATGGTCCCAGCTACACAGG + Intergenic
1185051811 22:48557930-48557952 GGGAAAGGTCCCACCTGCCCCGG - Intronic
1185310135 22:50149790-50149812 GGGAACAGTCACAGCTGTACAGG + Intronic
953663499 3:44908023-44908045 GGGAAAAGCCCCAGCTGCATGGG - Intronic
954676749 3:52320115-52320137 GGCCAGGGTCCCAGCTCCACAGG - Intronic
960961333 3:123072516-123072538 GGGGAGAATCCTAGCTGCACAGG - Intronic
962963990 3:140336855-140336877 GGGCTGCGTCACAGCTTCACAGG + Intronic
963064837 3:141255523-141255545 AGGAAGAGTCCCTGCTTCACCGG - Intronic
963960132 3:151300513-151300535 GGGAACAGACCCAGCTGCAGGGG - Intronic
968474853 4:799432-799454 GGGTAGCACCCCAGCTCCACGGG + Intronic
968790962 4:2661526-2661548 AGGCAGCGTCCCAGGTGCAGTGG + Intronic
976860391 4:89658755-89658777 TGGAAAGGTCCCTGCTGCACTGG + Intergenic
985107125 4:186510310-186510332 GGTCAGAGTCCCAGCTCCACTGG + Intronic
985761596 5:1751900-1751922 GGGAAAGGTCTCAGCTGCACAGG - Intergenic
987897457 5:23965889-23965911 GGGAGGCTTCCCAGATCCACGGG - Intronic
992194034 5:74322149-74322171 GGGGAACATCCCAGATGCACAGG + Intergenic
995684643 5:114759104-114759126 GGCAAGAGTCCCAGTTGTACAGG - Intergenic
996038143 5:118781519-118781541 TGGAAGGGTCCCAGAGGCACTGG - Intergenic
997297364 5:132776707-132776729 GGGAAGAGTCCTAGCCGCACAGG - Intronic
999289229 5:150412741-150412763 GGTCAGGGTCCCAGATGCACAGG - Exonic
999329565 5:150663158-150663180 GGGAAGCTTCCCTGAGGCACTGG + Intronic
999697553 5:154200018-154200040 AGGAAGCATCCCAGCTGGATTGG - Intronic
1002211179 5:177600227-177600249 GGAAAGCGGCGCAGCTGCCCTGG + Exonic
1002638312 5:180618889-180618911 CGGAAGCGTCCGCGCTGCTCGGG + Exonic
1004793141 6:19051162-19051184 GGGTCGGGTTCCAGCTGCACAGG - Intergenic
1008010048 6:46456918-46456940 GGGACGTGTCCCTGCTGCCCTGG + Exonic
1011793462 6:90925984-90926006 GAGAAGGGTGCAAGCTGCACTGG + Intergenic
1015096097 6:129416851-129416873 GCTAAGCGTGCCAGCTGCAGTGG + Intronic
1022209527 7:28195026-28195048 GTGAGGAGTCCCAGCAGCACAGG + Intergenic
1023847856 7:44132945-44132967 GGGAAACGTCACAGGTGCTCAGG + Intergenic
1029479179 7:100802566-100802588 GGGACGTGTCCCAGCTCCAGGGG - Exonic
1029716175 7:102327831-102327853 GGGAAGCAGCCCAGCTACTCGGG - Intergenic
1032936393 7:136737549-136737571 GGGAAGTGTCCAATCTGGACTGG + Intergenic
1035048318 7:155983559-155983581 GGGCAGCACCCCAGCTCCACGGG - Intergenic
1035170661 7:157015604-157015626 GGGCAGCCTCCCAGCTTCCCTGG + Intergenic
1035789757 8:2293642-2293664 GGGGTTCGTCCCATCTGCACAGG + Intergenic
1035803048 8:2428063-2428085 GGGGTTCGTCCCATCTGCACAGG - Intergenic
1036207888 8:6818766-6818788 GGGCTGAGGCCCAGCTGCACTGG + Intronic
1037737867 8:21581462-21581484 TGGCAGCGCCCCAGCTCCACAGG + Intergenic
1039414683 8:37383709-37383731 GGGCAGCTTGCCTGCTGCACAGG + Intergenic
1039847460 8:41335997-41336019 GGCATGCTTCCCACCTGCACTGG + Intergenic
1040550989 8:48437470-48437492 GAGCAGCCTCCCAGCTGCTCGGG - Intergenic
1057736312 9:97664773-97664795 GGGAAGGGTTCCAGCTTCAGTGG + Intronic
1060663964 9:125421939-125421961 GGGATCCCTCCCACCTGCACGGG - Intergenic
1060751078 9:126169990-126170012 GAGAAGCGAGCCAGCTGCATGGG + Intergenic
1061112669 9:128585978-128586000 GGGAAGCGTCTCACCTGCCAGGG + Intronic
1061867109 9:133498169-133498191 GGGGAGCGTCCCACCTCCACAGG - Intergenic
1200151835 X:153954964-153954986 GGCAGGGGTGCCAGCTGCACAGG + Exonic