ID: 1077008655

View in Genome Browser
Species Human (GRCh38)
Location 11:370423-370445
Sequence GGGAAGCGTCCCAGCTGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008655_1077008670 30 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008655_1077008661 -6 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008661 11:370440-370462 CTTCCCGGCGGGGGCGCCTTCGG 0: 1
1: 0
2: 0
3: 11
4: 73
1077008655_1077008667 17 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1077008655_1077008668 18 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157
1077008655_1077008666 16 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008666 11:370462-370484 GTGAACTGTGCCAGTGTTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1077008655_1077008665 15 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008655 Original CRISPR GGGAAGCGTCCCAGCTGCAC CGG (reversed) Intronic