ID: 1077008661

View in Genome Browser
Species Human (GRCh38)
Location 11:370440-370462
Sequence CTTCCCGGCGGGGGCGCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008655_1077008661 -6 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008661 11:370440-370462 CTTCCCGGCGGGGGCGCCTTCGG 0: 1
1: 0
2: 0
3: 11
4: 73
1077008651_1077008661 13 Left 1077008651 11:370404-370426 CCGGGGCTTGCTGAAGTGGCCGG 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1077008661 11:370440-370462 CTTCCCGGCGGGGGCGCCTTCGG 0: 1
1: 0
2: 0
3: 11
4: 73
1077008648_1077008661 19 Left 1077008648 11:370398-370420 CCCGGGCCGGGGCTTGCTGAAGT 0: 1
1: 0
2: 0
3: 14
4: 215
Right 1077008661 11:370440-370462 CTTCCCGGCGGGGGCGCCTTCGG 0: 1
1: 0
2: 0
3: 11
4: 73
1077008649_1077008661 18 Left 1077008649 11:370399-370421 CCGGGCCGGGGCTTGCTGAAGTG 0: 1
1: 0
2: 4
3: 12
4: 128
Right 1077008661 11:370440-370462 CTTCCCGGCGGGGGCGCCTTCGG 0: 1
1: 0
2: 0
3: 11
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008661 Original CRISPR CTTCCCGGCGGGGGCGCCTT CGG Intronic