ID: 1077008662

View in Genome Browser
Species Human (GRCh38)
Location 11:370443-370465
Sequence TCACCGAAGGCGCCCCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008665 -5 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008662_1077008666 -4 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008666 11:370462-370484 GTGAACTGTGCCAGTGTTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1077008662_1077008672 15 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG 0: 1
1: 0
2: 2
3: 10
4: 143
1077008662_1077008667 -3 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1077008662_1077008670 10 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008662_1077008671 11 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1077008662_1077008668 -2 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157
1077008662_1077008677 28 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222
1077008662_1077008676 27 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008662_1077008674 17 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 136
1077008662_1077008678 29 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008662_1077008673 16 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008662 Original CRISPR TCACCGAAGGCGCCCCCGCC GGG (reversed) Intronic
900959946 1:5912461-5912483 TCACCGAAAGCTCCGCCTCCCGG - Intronic
902470324 1:16644470-16644492 TCCCCCAAGTCGCCCCCGCCTGG + Intergenic
903435296 1:23344514-23344536 GCCCCGGAGGCGCCCCAGCCAGG - Intergenic
903628126 1:24745702-24745724 TCTCCTGAGGCGCCCCCGCTCGG + Intronic
904182558 1:28676648-28676670 TCACTGAAGGCTCCGCCTCCGGG - Intronic
904223997 1:28999293-28999315 TCACTGCAAGCGCCCCCTCCTGG - Intronic
905548470 1:38818056-38818078 GGGCTGAAGGCGCCCCCGCCCGG + Intergenic
905890141 1:41513567-41513589 TCCTCAGAGGCGCCCCCGCCTGG - Exonic
906050164 1:42864253-42864275 TCACTGAAGGCTCCGCCCCCCGG - Intergenic
906175805 1:43771430-43771452 TCACCGCAGGCTCCGCCCCCGGG + Intronic
906409190 1:45565546-45565568 TCACTGCAGCCTCCCCCGCCTGG + Intronic
906556567 1:46718896-46718918 CGACCGAAAGCGCTCCCGCCCGG + Exonic
907639039 1:56166973-56166995 TCACTGAAGGCTCCGCCCCCCGG - Intergenic
907773391 1:57488325-57488347 TCACTGCAAGCTCCCCCGCCCGG - Intronic
911498858 1:98661777-98661799 TCCCCGTTGGCGCCCCCGGCCGG - Exonic
914413733 1:147457578-147457600 TCACTGCAGGCTCCCCCTCCTGG - Intergenic
916886267 1:169071572-169071594 TCACTGAAGGCTCCACCTCCCGG + Intergenic
917421453 1:174868038-174868060 TCACCGCAGCCTCCGCCGCCTGG + Intronic
922335810 1:224617410-224617432 GCACCGAAGGCGCGCCCGGCGGG - Intronic
922502877 1:226110033-226110055 TCCCCGGAGCAGCCCCCGCCCGG - Intergenic
922509974 1:226157312-226157334 TCACCGAAACCTCCCCCTCCTGG + Intronic
1063696258 10:8337970-8337992 TCACCGAAAGCTCCGCCTCCCGG - Intergenic
1064443208 10:15371370-15371392 GCGCCGAGGGCGCCCCCGCCCGG + Intergenic
1065820226 10:29518311-29518333 TCACTGAAGCCTCCCCCTCCTGG - Intronic
1068104790 10:52601210-52601232 TCACCGAAAGCTCCGCCTCCCGG + Intergenic
1069709295 10:70478717-70478739 TCACCGCGCCCGCCCCCGCCCGG - Intergenic
1073249219 10:102111485-102111507 TCGCCGAAGGAGCCCCCGAACGG - Exonic
1073414266 10:103368211-103368233 GCACCGGGGCCGCCCCCGCCGGG - Exonic
1077008662 11:370443-370465 TCACCGAAGGCGCCCCCGCCGGG - Intronic
1080523949 11:33094971-33094993 TCACCGCAGCCTCCCCCTCCAGG + Intronic
1080683831 11:34499314-34499336 TCACCGCAGGCTCACCCTCCTGG + Intronic
1084848556 11:71920030-71920052 TCACCGAAAGCTCCGCCTCCCGG + Intronic
1086217524 11:84401755-84401777 TCACCGAAAGCTCCGCCTCCTGG + Intronic
1099053801 12:77812659-77812681 TCACCTAGGGCGCTCCCGCCTGG + Intergenic
1099846587 12:88035441-88035463 TCCCAGAAGGCGCCGCGGCCAGG + Exonic
1101181725 12:102226352-102226374 TCACTGAAGGCTCCGCCTCCCGG + Intergenic
1102071336 12:110022372-110022394 TCACCGAAAGCTCCGCCTCCTGG - Intronic
1104289589 12:127455677-127455699 TCCCCTCTGGCGCCCCCGCCCGG - Intergenic
1115693715 14:35874139-35874161 TCACCGCAGGCTCCGCCTCCTGG - Intronic
1124769410 15:32518372-32518394 TCACCGCAAGCTCCCCCTCCCGG - Intergenic
1125518750 15:40336930-40336952 TCCCCAAAAGCGCCCTCGCCTGG + Intronic
1125846090 15:42855757-42855779 TCACCGCAGGCTCCGCCTCCCGG + Intronic
1132055794 15:98649414-98649436 ACTCCGAAGGCGGCGCCGCCGGG - Exonic
1132679932 16:1135627-1135649 TCACCGAAGCCTCCACCTCCTGG + Intergenic
1132702069 16:1226211-1226233 TCCCCTGAGGCGCCCCCTCCAGG - Intergenic
1132706245 16:1244656-1244678 TCCCCTGAGGCGCCCCCTCCAGG + Intergenic
1137266677 16:46874550-46874572 TCACTGAAGGCTCCGCCTCCCGG - Intergenic
1140401942 16:74678867-74678889 TGACCCAAAGCGCCCCCGCAAGG + Intronic
1141650342 16:85389383-85389405 TCACCGCAACCTCCCCCGCCCGG - Intergenic
1142627175 17:1199521-1199543 TCACCGCAGCCTCCCCCTCCCGG + Intronic
1143020672 17:3915870-3915892 TCACCGAAGGCCCCCGGGCAGGG + Intronic
1143540013 17:7563156-7563178 CCAACGAAGACGCTCCCGCCTGG - Exonic
1145109215 17:20147144-20147166 TCACCGCAGGCTCCGCCTCCTGG + Intronic
1148440413 17:47709015-47709037 CCACCGCCGCCGCCCCCGCCGGG + Exonic
1148732519 17:49846096-49846118 TCTCCGAATGCCCCCCCACCAGG - Intronic
1158473534 18:57759742-57759764 TCACCGAAAGCTCCGCCTCCCGG - Intronic
1160594602 18:79964857-79964879 GCACCGCAGGCTCCCCCCCCAGG - Intronic
1160742497 19:693812-693834 TCACTGAAAGCGCCGCCTCCCGG + Intronic
1160823913 19:1070778-1070800 GCACAGAAGGCGCCCCCAGCCGG - Intronic
1163841524 19:19613857-19613879 TCACGGAAGGCACCCTCTCCTGG + Intronic
1167188189 19:47963046-47963068 TCACTGAAACCGCCCCCTCCCGG + Intergenic
1167743636 19:51339003-51339025 TCCCCGAAGGCATCCGCGCCGGG - Exonic
935981870 2:108635623-108635645 TCACCGAAACCTCCCCCTCCTGG - Intronic
937507854 2:122557020-122557042 TCACTGCAGGCTCCCCCACCGGG - Intergenic
942464748 2:176195768-176195790 TCACCGAAAGCTCCTCCTCCTGG - Intergenic
946339973 2:219060578-219060600 CCGCCCATGGCGCCCCCGCCTGG - Intergenic
946373567 2:219294951-219294973 TGAGCGCGGGCGCCCCCGCCTGG - Intronic
946835624 2:223769816-223769838 TCACTGAAGGCTCCGCCCCCCGG + Intronic
948491403 2:238315401-238315423 TCAGGGAAGGCGGCCCAGCCGGG + Intergenic
1170023835 20:11866486-11866508 TCACTGCAAGCGCCCCCTCCCGG - Intergenic
1174251223 20:49221034-49221056 TCACCGCAGCCTCCCCCTCCCGG + Intronic
1179772794 21:43635852-43635874 TCACTGCAGTCGCCCCCTCCTGG - Intronic
1182746440 22:32609247-32609269 TCACCGAAAGCTCCGCCTCCCGG - Intronic
1184251100 22:43260797-43260819 TCACCCCAGCTGCCCCCGCCAGG - Intronic
950664514 3:14487145-14487167 TCACCCAGGGAGCCCCCGCTGGG - Exonic
954110139 3:48429155-48429177 TCACCCAGGCCGCCCCTGCCCGG + Intronic
954194537 3:48988807-48988829 TCACCGAAAGCTCCGCCTCCCGG - Intergenic
954299098 3:49689760-49689782 TCCCCCAAGTCGCCCCCGCCTGG - Intronic
966648624 3:182274266-182274288 TCACCGCAGGCTCCGCCTCCTGG + Intergenic
967889945 3:194357915-194357937 TCATCGGAGGCCCCTCCGCCTGG - Exonic
967969051 3:194985882-194985904 TCACTGCAGGCTCCCCCTCCCGG + Intergenic
968310610 3:197680644-197680666 TCAGGGAAGGCCCCTCCGCCAGG + Intronic
968965079 4:3765714-3765736 TCGGCGAGGGCGCCCCCTCCAGG - Intergenic
971254548 4:25002240-25002262 TTACCAAAGGAACCCCCGCCAGG - Exonic
972508109 4:39740466-39740488 TCACTGAAGGCTCCGCCTCCCGG - Intronic
972587312 4:40449751-40449773 TCACTGAAGCCTCCACCGCCCGG + Intronic
972953446 4:44358641-44358663 TCACCGAAAGCTCCGCCTCCCGG + Intronic
979906184 4:126296725-126296747 TCACCGAAGCCTCCACCTCCGGG - Intergenic
983112289 4:163767406-163767428 TCACCGCAAGCTCCCCCTCCTGG + Intronic
984888701 4:184473377-184473399 TCCCCGCAGGCGCCCCCGGCCGG - Intronic
986306984 5:6523262-6523284 GCACGGGAGGCGCCCCCACCCGG - Intergenic
1001513904 5:172341723-172341745 TCACTGCAGGCTCCGCCGCCTGG + Intronic
1010405161 6:75496621-75496643 TCACCGCAGGCTCCGCCTCCCGG + Intergenic
1013441771 6:110179129-110179151 TCACCTGAGGTGCCACCGCCCGG - Intronic
1014137546 6:117907203-117907225 CCGCCGCCGGCGCCCCCGCCCGG + Intergenic
1014610632 6:123540592-123540614 TCACCGCAGGCTCCGCCTCCTGG + Intronic
1019631491 7:2052073-2052095 TCCACGAAGGAGCCCCCGGCAGG + Intronic
1021825737 7:24549191-24549213 TCACCGCAGGCCCCGCCTCCCGG - Intergenic
1024023613 7:45392205-45392227 TCACAGATGGGGCCCCCGCTGGG + Intergenic
1034118963 7:148609876-148609898 TCAGCGAAGACTCCCCCTCCAGG - Intronic
1036127237 8:6074452-6074474 TCACCGCAAGCTCCCCCTCCCGG + Intergenic
1041654724 8:60337071-60337093 TCACCGCAAGCTCCGCCGCCCGG - Intergenic
1047961755 8:130016335-130016357 GCTCTGAAGGCGCCGCCGCCCGG - Intronic
1047987811 8:130253944-130253966 TCACCGAAAGCTCCACCTCCTGG - Intronic
1048352276 8:133625645-133625667 TCACTGCAGGCGCCGCCTCCTGG - Intergenic
1049108653 8:140629342-140629364 TCAGCGCAGGCGCCCGTGCCCGG + Intronic
1049705089 8:144038051-144038073 TCACTGAAGGCTCCGCCCCCCGG - Intronic
1049801260 8:144518357-144518379 TTCGCGAAGACGCCCCCGCCCGG - Intronic
1053050500 9:34957876-34957898 GCCCCCAAGGCGCCCCCTCCGGG + Intronic
1053545565 9:39019853-39019875 TCACCGAAACCTCCACCGCCTGG + Intergenic
1053768579 9:41438839-41438861 TCACTGAAAGCTCCGCCGCCTGG + Intergenic
1055120560 9:72655665-72655687 TCACTGCAGGCTCCCCCTCCCGG - Intronic
1062403754 9:136383757-136383779 ACCCCGGAGGCGCCCCCGCTTGG - Intronic
1185454952 X:304677-304699 GCACCGACGGCCCCTCCGCCCGG - Intronic
1192165554 X:68825478-68825500 TCACCTAAGGCCACCCAGCCAGG - Intergenic