ID: 1077008662

View in Genome Browser
Species Human (GRCh38)
Location 11:370443-370465
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008671 11 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1077008662_1077008672 15 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG 0: 1
1: 0
2: 2
3: 10
4: 143
1077008662_1077008665 -5 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008662_1077008667 -3 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1077008662_1077008666 -4 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008666 11:370462-370484 GTGAACTGTGCCAGTGTTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1077008662_1077008678 29 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008662_1077008674 17 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 136
1077008662_1077008677 28 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222
1077008662_1077008673 16 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1077008662_1077008670 10 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008662_1077008668 -2 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157
1077008662_1077008676 27 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008662 Original CRISPR TCACCGAAGGCGCCCCCGCC GGG (reversed) Intronic