ID: 1077008663

View in Genome Browser
Species Human (GRCh38)
Location 11:370444-370466
Sequence TTCACCGAAGGCGCCCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008663_1077008673 15 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1077008663_1077008672 14 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG 0: 1
1: 0
2: 2
3: 10
4: 143
1077008663_1077008667 -4 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1077008663_1077008670 9 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008663_1077008674 16 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 136
1077008663_1077008676 26 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008663_1077008677 27 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222
1077008663_1077008666 -5 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008666 11:370462-370484 GTGAACTGTGCCAGTGTTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1077008663_1077008668 -3 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157
1077008663_1077008665 -6 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008663_1077008678 28 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008663_1077008671 10 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008663 Original CRISPR TTCACCGAAGGCGCCCCCGC CGG (reversed) Intronic
901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG + Intronic
904970055 1:34412472-34412494 TTCACAGACGGTGCCCCCACTGG - Intergenic
922335811 1:224617411-224617433 GGCACCGAAGGCGCGCCCGGCGG - Intronic
1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG + Intronic
1066080861 10:31929024-31929046 TTGACCGCAGGCTCCCGCGCCGG - Intergenic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077332937 11:1991266-1991288 TTCCAGGAAGGGGCCCCCGCTGG + Intergenic
1202815920 11_KI270721v1_random:46442-46464 TTCCAGGAAGGGGCCCCCGCTGG + Intergenic
1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG + Exonic
1102043342 12:109814765-109814787 TCCAGCGAAGGCCCCCGCGCGGG - Exonic
1102890137 12:116552503-116552525 TTCTACGAAGGCGCCCACCCGGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1129750357 15:78058666-78058688 TTCACCAAAGACACGCCCGCCGG + Intronic
1132055795 15:98649415-98649437 TACTCCGAAGGCGGCGCCGCCGG - Exonic
1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG + Intronic
1148646690 17:49223492-49223514 TTCACCAAAGTCACCCTCGCGGG - Exonic
1151887739 17:76933070-76933092 TCCACCGAAGACGCCCTTGCTGG - Intronic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1161480987 19:4510571-4510593 TTCACCCAAGGGGCCGCCCCAGG - Exonic
1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG + Exonic
948933653 2:241149066-241149088 TTCACCGCAGCCGGCCCTGCGGG - Intronic
1180795890 22:18605143-18605165 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
1181225834 22:21390128-21390150 TTCCCCGAGGGCATCCCCGCAGG + Intergenic
1181252799 22:21544685-21544707 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
969511040 4:7618150-7618172 TTCACAGAAGCCTCCTCCGCAGG + Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1013282919 6:108655710-108655732 TACACCGAAGGCGCCCACCCGGG + Intronic
1018900626 6:168050094-168050116 TGCACAGAGGCCGCCCCCGCAGG - Intergenic
1022100210 7:27164927-27164949 TTCAGAGAAGGCGCCTTCGCTGG + Exonic
1024023612 7:45392204-45392226 GTCACAGATGGGGCCCCCGCTGG + Intergenic
1029273812 7:99392695-99392717 TTCACCTATGACGCCGCCGCGGG + Exonic
1055530355 9:77177575-77177597 TTCAGCTGCGGCGCCCCCGCTGG - Exonic
1060276778 9:122188514-122188536 TGGACCGAAGGGGCCCCGGCAGG - Intronic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic