ID: 1077008664

View in Genome Browser
Species Human (GRCh38)
Location 11:370456-370478
Sequence ACACTGGCACAGTTCACCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008664_1077008677 15 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222
1077008664_1077008676 14 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008664_1077008672 2 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG 0: 1
1: 0
2: 2
3: 10
4: 143
1077008664_1077008679 23 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008679 11:370502-370524 GGGGCCCAGCTTGGGGAGCCTGG 0: 1
1: 0
2: 2
3: 47
4: 435
1077008664_1077008670 -3 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008664_1077008673 3 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1077008664_1077008671 -2 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1077008664_1077008678 16 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008664_1077008674 4 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008674 11:370483-370505 GGGGTCCATGCGTAGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008664 Original CRISPR ACACTGGCACAGTTCACCGA AGG (reversed) Intronic
901198334 1:7452794-7452816 ACAGTGGCACACTTCACACAAGG - Intronic
903695606 1:25204321-25204343 ACAGTGGCAGAGTTGACAGATGG - Intergenic
904116218 1:28163907-28163929 ACATGGGCACAGTTCCCTGATGG + Intronic
912865471 1:113252459-113252481 AAACTGACAGAGTTCACAGATGG + Intergenic
920630406 1:207646055-207646077 ACACGGACACTGTTCACAGAAGG - Intronic
923681915 1:236125195-236125217 TCCCTGGCACAGTTTGCCGATGG + Intergenic
1062935814 10:1387534-1387556 AAACTGTCAAAGTTCACTGATGG + Intronic
1063372200 10:5529243-5529265 ACTCTGACTCAGTTCACCCACGG + Intergenic
1063656585 10:7996439-7996461 ACACTGGCACAGTTCCCTCACGG - Intronic
1067821900 10:49538240-49538262 ACACAGGCACAGTTCTGAGAGGG + Intronic
1069750878 10:70744259-70744281 ACTGTGGCACAGTTCAAGGAGGG - Intronic
1074757407 10:116634737-116634759 TCACCTGCACATTTCACCGATGG - Intronic
1077008664 11:370456-370478 ACACTGGCACAGTTCACCGAAGG - Intronic
1077412010 11:2408040-2408062 CCACTGTCCCAGTTCACCCAGGG + Intronic
1077978523 11:7275184-7275206 ACACTGGCAAAGTTCATAGCTGG - Intronic
1083171615 11:60926820-60926842 ACACTGGCCCAGTCTGCCGACGG + Intronic
1086291410 11:85314797-85314819 ACTGTGGGACAGTTCACAGAGGG + Intronic
1086740649 11:90363962-90363984 ACACTGGCCCATTTAACCCATGG + Intergenic
1088413471 11:109563371-109563393 AAACTGTCACTGTTCACCAATGG - Intergenic
1092211997 12:6652377-6652399 ACACTGCCAAAGGTCACTGAGGG + Exonic
1094566178 12:31600266-31600288 ACCCTGGCTCAGGCCACCGAAGG + Intergenic
1098070300 12:66667597-66667619 TCACTGGCAGACTTCACCCAAGG + Intronic
1101910336 12:108856719-108856741 ACGCTGGCACAGTCCCCGGACGG + Intronic
1108333339 13:49412801-49412823 TCACATGCACAGTTCACAGAAGG + Intronic
1110457048 13:75700759-75700781 ACAAAGGGACAGTTCACAGAGGG + Intronic
1112427240 13:99313670-99313692 GCACTGGCACGGTTCACCTCTGG - Intronic
1115784290 14:36806869-36806891 ACACTGCCAGAGTTCAGCCATGG - Intronic
1121575121 14:94978350-94978372 CCACAGGCAAAGTTCACAGAGGG - Intergenic
1121724022 14:96132988-96133010 ACAAAGGCACAGTTCATGGAGGG - Intergenic
1125514775 15:40312122-40312144 AAACTGGCCCATTTCACAGAGGG - Intergenic
1129797136 15:78386474-78386496 AAACTGCCACAGTTCAGCCAGGG + Intergenic
1132196348 15:99917202-99917224 ACACTGCCAGAGGTCACCCAGGG - Intergenic
1135753967 16:25080989-25081011 ACACTGGCAAACTTGACGGATGG - Intergenic
1140094618 16:71864195-71864217 ACACTGGCAGAGTTCAAGCAAGG + Exonic
1142504833 17:356754-356776 CCACTGGCACAGGCCTCCGAAGG - Intronic
1143133615 17:4697064-4697086 AGACTGGATCAGTTCACCAAGGG + Intronic
1144306907 17:13976881-13976903 AAACGGGCACAGTTCCTCGAAGG - Intergenic
1159014245 18:63088602-63088624 ACCCTGGGACAGCCCACCGAAGG - Intergenic
1164193350 19:22931666-22931688 AAACTGACACAGTTCACAGTTGG + Intergenic
1166281937 19:41799933-41799955 ACTCTGGCACAGCTCACCTGTGG + Intronic
928355147 2:30605940-30605962 TCACTTGCACAGTTCACAGGAGG + Intronic
943162310 2:184269933-184269955 TCACATGCACAGTTCACAGAAGG + Intergenic
946133978 2:217630321-217630343 CCACTGGCAGAGTTCACCAAGGG + Intronic
1176520651 21:7821675-7821697 ACACAGCCACAGTTCAGAGATGG - Intronic
960482774 3:118213530-118213552 ACACTGGCATAGCACACAGAAGG - Intergenic
967999989 3:195198895-195198917 AGAGTGGCAGAGTTCTCCGACGG + Intronic
968906300 4:3452993-3453015 ACAGTGGAACAGTTCAAGGAGGG - Intergenic
970162815 4:13206335-13206357 AGACCGGCACAGTTCCCCAAAGG + Intergenic
972301820 4:37792032-37792054 ACATTGGCACATTTCATCCATGG - Intergenic
973786740 4:54339488-54339510 ACAGTGACACAGTTCACAAATGG + Intergenic
979584526 4:122399937-122399959 AAACTGTCACTGTTCACTGATGG - Intronic
987704746 5:21447814-21447836 AAACTGTCACCGTTCACTGATGG - Intergenic
989467727 5:41776260-41776282 AAACTGGCACAGATCAGAGAAGG + Intronic
992069675 5:73137123-73137145 AGTCTGGCGCAGTCCACCGAAGG - Intergenic
1003073875 6:2966552-2966574 CCACGTGCACAGTTCACCGTAGG - Intronic
1003363440 6:5450498-5450520 ACCCGGCCACACTTCACCGATGG - Intronic
1003562678 6:7195831-7195853 AAACTGGCACAGTTGAGGGAGGG - Intronic
1003564328 6:7209891-7209913 AATCTGGCACAGTTCAACCACGG + Intronic
1007207860 6:40167223-40167245 AGACTGCCACAGTTCTCCAATGG - Intergenic
1008087294 6:47258463-47258485 ACACTGGAACAGTTTCCCCAGGG + Intronic
1008278737 6:49571072-49571094 AAACTGGCACAGTTCCTGGAAGG + Intergenic
1013935354 6:115587324-115587346 ACATTGGCACCTTTCAGCGATGG - Intergenic
1018566619 6:165161628-165161650 ACACTGGCCCATTTGACCCATGG + Intergenic
1023056019 7:36290681-36290703 ACTCTTGCTCAGTTCACAGAGGG - Intronic
1029379251 7:100201983-100202005 ACTCTGGCAGAGTTCACAGAAGG - Exonic
1032859549 7:135864194-135864216 ACACTGGCACAGATCTGTGAAGG + Intergenic
1049349449 8:142156476-142156498 ACACTGGAACAGTGAACAGAAGG - Intergenic
1056288627 9:85117660-85117682 GAACTGGCACAGATCACAGAGGG - Intergenic
1186443134 X:9603499-9603521 ACACTCTCACAGAACACCGAGGG + Intronic
1193215329 X:78856990-78857012 ACACTGGCACAGATCCCAAAAGG + Intergenic
1197348945 X:125359077-125359099 ACACTGGCCCACTTCAGCCATGG - Intergenic
1201339848 Y:12922866-12922888 ACACTGGCAGAATACACAGACGG - Intergenic