ID: 1077008665

View in Genome Browser
Species Human (GRCh38)
Location 11:370461-370483
Sequence GGTGAACTGTGCCAGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008665 -5 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008655_1077008665 15 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008663_1077008665 -6 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008665 Original CRISPR GGTGAACTGTGCCAGTGTTG TGG Intronic
905672278 1:39799589-39799611 GGTGACCTGATCCAGGGTTGGGG + Intergenic
905674682 1:39817219-39817241 GGTGACCTGATCCAGGGTTGGGG - Intergenic
916702263 1:167309405-167309427 AGTGAAGTGTACCACTGTTGGGG - Intronic
920371543 1:205482236-205482258 GAAGAACTGTCCCAGTGTTGGGG + Intergenic
920505695 1:206513761-206513783 GGGGAACAGAGCCAGTTTTGGGG + Intronic
920998039 1:211013881-211013903 GGTGATCTGTGTGAGTGTTTTGG + Intronic
921946593 1:220890049-220890071 GGTGGACTGTGCTAGAGGTGAGG - Intergenic
922055228 1:222036253-222036275 GGGGAACTGTGCATGTGTAGGGG + Intergenic
924830471 1:247588829-247588851 GGTGGACTGTACCAGGGTGGTGG - Exonic
1065068628 10:21999832-21999854 GGTGAACTCATCCAGTTTTGTGG + Intronic
1066118019 10:32257325-32257347 AGTGAACAGTCCCAGTGTGGCGG + Intergenic
1067816088 10:49477731-49477753 GGTGAGCTGTGGCAGTGCTTTGG - Intronic
1068492797 10:57745125-57745147 GGTGAACTATGACCCTGTTGTGG - Intergenic
1068689271 10:59899556-59899578 GGTGACCTGTAGCAGTGATGGGG - Intronic
1070258185 10:74827748-74827770 GGTGGACTGTGCCAGGGGTGAGG + Intronic
1072805338 10:98420424-98420446 AGTGAACTGGGCTAGTGTGGTGG + Intronic
1072805668 10:98422722-98422744 TGTCAAATGTGCAAGTGTTGAGG - Intronic
1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG + Intronic
1079187161 11:18248046-18248068 GGGAAGCTGTGCCAGTCTTGTGG - Intronic
1079189640 11:18266831-18266853 GGGAAGCTGTGCCAGTCTTGTGG + Intronic
1080839078 11:35967692-35967714 GGTGCACCATGCCAGAGTTGTGG + Intronic
1081411361 11:42762289-42762311 GTTGATCTGTGCCAGTGATGTGG - Intergenic
1082655829 11:55856185-55856207 GGTGGTCTTTGCCAGTTTTGTGG + Intergenic
1083662483 11:64258220-64258242 TGTGAGCTGTGCCAGGGCTGAGG + Intronic
1084707652 11:70824616-70824638 GGTGACCTGTCCCAGGGATGAGG - Intronic
1085351449 11:75800499-75800521 GGTGAACTGAGCCAGCCTTCGGG + Exonic
1085529463 11:77182930-77182952 GGTGGACGGTGGCAGTGTGGGGG + Intronic
1089084314 11:115803863-115803885 GGAGAACTGTCTCAGGGTTGAGG - Intergenic
1094852608 12:34388985-34389007 GGTCATTTTTGCCAGTGTTGGGG + Intergenic
1097929233 12:65166321-65166343 AGTGAGCAGTGACAGTGTTGAGG + Intergenic
1098736825 12:74115590-74115612 GTTGAAATCTGCCAATGTTGTGG + Intergenic
1099959944 12:89387416-89387438 GCTTAACGGTGCCACTGTTGTGG - Intergenic
1101874129 12:108587861-108587883 GGTCAACTGTGTGGGTGTTGGGG - Intergenic
1102517317 12:113458482-113458504 GGGGCACTGTGCTAGTGTTGGGG + Intergenic
1102947071 12:116999320-116999342 GGAGAACTGTGCCAGGGACGTGG + Intronic
1102956131 12:117060284-117060306 GGTGAACCGCCCCAGAGTTGGGG + Intronic
1104236277 12:126940553-126940575 GGTAATCTGTGCATGTGTTGGGG + Intergenic
1104724184 12:131066010-131066032 GGTGAACTCTGGCAGGGGTGAGG + Intronic
1105936649 13:25106688-25106710 GGTCGACTTTGCCAGTGGTGGGG + Intergenic
1107568117 13:41627636-41627658 GGTGCACTGTTCCAGTGTGGAGG - Intronic
1109285427 13:60403089-60403111 GTTAAACTGTGCAAGTGTTCAGG + Intronic
1109535041 13:63705376-63705398 TGTGAACTGTACCAGTTTTTAGG + Intergenic
1111376647 13:87387958-87387980 GGTGATCTTTGCTAGTGTTCTGG - Intergenic
1111982456 13:95031261-95031283 GGTGACCTGAGCCAGTGGTTAGG + Intronic
1112427241 13:99313675-99313697 GGTGAACCGTGCCAGTGCCATGG + Intronic
1112759115 13:102672993-102673015 GATGAACTCTGCCAGTGTGAAGG + Intronic
1119876560 14:78064788-78064810 GCTGAACTGTGTCTGTGTTCTGG + Intergenic
1120148854 14:81009860-81009882 CGTCAACTGTGCCAGTTGTGGGG + Intronic
1120366142 14:83572724-83572746 GTTGTACTTTTCCAGTGTTGTGG + Intergenic
1122893111 14:104742069-104742091 GGTGAGCAGTGCCAGGGTGGAGG + Intronic
1123758663 15:23416322-23416344 GGTGCAGGGTGCCTGTGTTGGGG + Intergenic
1124375536 15:29126781-29126803 GGTGAACAGGGCCAGTGCAGGGG + Intronic
1126093002 15:45068321-45068343 GGTTATCTGTGACAGTGTGGAGG + Intronic
1127807600 15:62535352-62535374 GGTGATCTATGGCAGTGGTGTGG + Intronic
1127880732 15:63156559-63156581 GGTTAAATGTGCCAGCGTTGTGG - Intronic
1132811405 16:1799895-1799917 GGTTAACTGTTCCCGTGTGGTGG + Intronic
1134144929 16:11753220-11753242 CGTGAACTGAGCCACTGCTGTGG + Intronic
1135673189 16:24392163-24392185 GGTGAGCTGGTCCTGTGTTGTGG - Intergenic
1137510776 16:49098131-49098153 GGTGAACTGTGCCCTTGATCTGG - Intergenic
1137776049 16:51055101-51055123 GGTGAACTGTGTGTGTGTTAGGG + Intergenic
1139347929 16:66316411-66316433 AGTGAATTGTGCCAGACTTGGGG + Intergenic
1139931314 16:70528934-70528956 TATGTACTTTGCCAGTGTTGGGG - Exonic
1142394666 16:89825224-89825246 GCTGCACTGTGGCAGTGATGAGG + Intronic
1143786116 17:9256982-9257004 GGTGTTCTGTGCTAGGGTTGGGG - Intronic
1153998613 18:10463896-10463918 GGGGAGCTGTGCCAGCCTTGGGG + Intronic
1156194792 18:34762282-34762304 GTTGGACTGTGCATGTGTTGGGG + Intronic
1156202895 18:34854572-34854594 AATGAACTATGCCAGAGTTGAGG + Intronic
1162794394 19:13079026-13079048 GGAGAACTGGGCCAGAGTTGGGG - Intronic
1163216861 19:15885475-15885497 GATGAACAGTGCAAGTGTTCCGG + Intronic
1163578339 19:18123495-18123517 GGGGATCTGAGCCAGGGTTGAGG - Intronic
1168310090 19:55455840-55455862 GGCCACCTGTGCCAGTGATGGGG + Exonic
926012787 2:9422346-9422368 AATGAACTGTGCCCGGGTTGTGG - Intronic
926371970 2:12187869-12187891 GGAGAAATGTGGAAGTGTTGAGG + Intergenic
926752105 2:16206009-16206031 GGTGGTCTCTGCCCGTGTTGGGG + Intergenic
926861305 2:17312260-17312282 GCTGAACTGTGCCAGTCTTTAGG - Intergenic
927186329 2:20485157-20485179 GGGGAACTGAGACAGTGGTGGGG + Intergenic
936145686 2:109979268-109979290 GGGAAACTGTGCCAGTGTCTGGG - Intergenic
936199000 2:110392210-110392232 GGGAAACTGTGCCAGTGTCTGGG + Intergenic
938836813 2:135112275-135112297 GGTGACCTGGGACGGTGTTGCGG - Intronic
939013159 2:136871107-136871129 GGTGAAGTGTGACACTGTCGGGG + Intronic
939621861 2:144430003-144430025 GGTGAACTATGACAATGTAGTGG - Exonic
943510533 2:188820675-188820697 CTTGAACTGTGCGTGTGTTGGGG - Intergenic
948068284 2:235098916-235098938 AGTGAACTCTGCCAGTGTTTTGG + Intergenic
948781946 2:240327125-240327147 GAAGAACTTTGCCAGTGCTGCGG - Intergenic
1173460150 20:43236750-43236772 GGTGGCATGTGCCAGAGTTGGGG - Intergenic
1181549533 22:23629407-23629429 GATGGACTGTCCCACTGTTGGGG - Intronic
1181925467 22:26355163-26355185 GGTGAAGAGTGTTAGTGTTGGGG - Intronic
1182248404 22:28979402-28979424 GGTGAAGGGCACCAGTGTTGTGG + Intronic
1182516910 22:30864305-30864327 GGTGAACGGGCCCAGTGCTGGGG + Intronic
1183121251 22:35731808-35731830 GGTGACCTGAACCAGTGTGGTGG + Intergenic
1183265852 22:36824533-36824555 CGTGGGCTGTGCCAGTGATGGGG - Intergenic
1184594920 22:45508055-45508077 GGTGAACTGGGGCAGGGGTGGGG - Intronic
949526312 3:4908103-4908125 GAAAAACAGTGCCAGTGTTGGGG + Intergenic
956412757 3:68995463-68995485 GCTTAACTGTGCCAGAGCTGAGG + Intronic
961212836 3:125139410-125139432 GGTCCACTGTGCCAGCTTTGGGG - Intronic
962843000 3:139252358-139252380 GGTGAAATGAGCCAGGGTTATGG + Intronic
967822793 3:193853795-193853817 TGTGAACTGGGCCTGTGGTGTGG - Intergenic
971830042 4:31680213-31680235 GTTCAACTGTGCCATTGTGGTGG + Intergenic
972317014 4:37936072-37936094 GGTGATCTGTGCCAGAGTAAAGG - Intronic
980148553 4:129019767-129019789 GCTGCACTGTGGCAGTGGTGTGG - Intronic
987106722 5:14646986-14647008 GCTGAACTGGTCCAGGGTTGAGG + Intergenic
988358127 5:30202514-30202536 GGAGAACAGTGGCAGGGTTGAGG - Intergenic
989956377 5:50365845-50365867 GCTGAGCTGTGCCAGTTTGGGGG - Intergenic
998171935 5:139877593-139877615 GGTGAACAGGGCCACTGCTGGGG - Intronic
998822935 5:146073161-146073183 GGTCAACGGTGCCAGGGTTGGGG + Intronic
1000965264 5:167648452-167648474 GGGGATCTGTTCCAGTGATGGGG + Intronic
1001169425 5:169404707-169404729 GGCCAACTGTGCCGGTTTTGGGG - Intergenic
1005520289 6:26595331-26595353 GGTAAGTTGTGCCAGTGTGGTGG - Intergenic
1007577508 6:42935473-42935495 GGTGAGATGTGCAGGTGTTGGGG + Intronic
1009343232 6:62585892-62585914 CGTCAACAGTCCCAGTGTTGAGG + Intergenic
1013730413 6:113157765-113157787 GGTGAAGGGTGACAGAGTTGGGG - Intergenic
1017940231 6:159046391-159046413 GGTGAACTCTGGCACTGTGGTGG - Intergenic
1018898227 6:168035927-168035949 GGTGCACTGGGCCAGGGCTGGGG + Intronic
1019184059 6:170210668-170210690 TTTGAACTCTACCAGTGTTGAGG + Intergenic
1021834466 7:24655407-24655429 GGTGAAGTGTGCCTTGGTTGGGG + Intronic
1023940553 7:44766224-44766246 GGTGAACTCAGCAAGGGTTGGGG - Exonic
1024802624 7:53098724-53098746 GGGGCAGTGTGCCTGTGTTGGGG + Intergenic
1031560343 7:123230768-123230790 GGTGGACTGTGCAAGTGGAGGGG + Intergenic
1032655756 7:133928247-133928269 GGTCACCTGTGCCATTGTGGTGG + Intronic
1033490757 7:141841263-141841285 GGAGGACTGTGCCTCTGTTGGGG + Exonic
1035058956 7:156055177-156055199 GGTGACCTGTGGCAGAGGTGAGG + Intergenic
1036531944 8:9598607-9598629 GATCAACTGAGCCAGTGATGCGG + Intronic
1037449364 8:19001391-19001413 GGGAAACTGTGCATGTGTTGGGG - Intronic
1037697097 8:21233220-21233242 GGAGAACTGAGCTAGGGTTGAGG - Intergenic
1041094743 8:54338885-54338907 GGTGAACAGGGCCAGTTCTGAGG + Intergenic
1047916747 8:129591921-129591943 GGTGACCTCTGCTAGTGTTAAGG + Intergenic
1051470018 9:17427741-17427763 GTTGAAGTAAGCCAGTGTTGGGG + Intronic
1053025733 9:34726712-34726734 TGTTAATTGTGACAGTGTTGGGG + Exonic
1055491686 9:76811521-76811543 GCTGAACTCTGCCAGTGTCGTGG + Intronic
1061169554 9:128944355-128944377 GGTCAACTTTGGCAGGGTTGAGG - Intronic
1187190317 X:17028256-17028278 AGTGAACTGTGGCATGGTTGGGG - Intronic
1187458394 X:19463400-19463422 GGTCAGCTCTGCCAGTGTTTGGG + Intronic
1187794498 X:22987247-22987269 GGAGAATTGTACCAGTCTTGTGG - Intergenic
1188137654 X:26509555-26509577 GCTGAACTTTGACAGTTTTGAGG + Intergenic
1188188265 X:27143676-27143698 GGTGAACTCTGCAAGTGTCTGGG - Intergenic
1190544498 X:51511434-51511456 GGTGATCTTTTCCAGTATTGTGG + Intergenic
1198374035 X:136019919-136019941 GGTGACCCTTGACAGTGTTGAGG + Intronic
1200358704 X:155578815-155578837 TGTGAAGTGTGCCAGTTTTGGGG - Intronic
1201487890 Y:14511224-14511246 GGAGAAAAGTGGCAGTGTTGAGG - Intergenic