ID: 1077008665

View in Genome Browser
Species Human (GRCh38)
Location 11:370461-370483
Sequence GGTGAACTGTGCCAGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008663_1077008665 -6 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008662_1077008665 -5 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1077008655_1077008665 15 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008665 11:370461-370483 GGTGAACTGTGCCAGTGTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008665 Original CRISPR GGTGAACTGTGCCAGTGTTG TGG Intronic