ID: 1077008667

View in Genome Browser
Species Human (GRCh38)
Location 11:370463-370485
Sequence TGAACTGTGCCAGTGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008663_1077008667 -4 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1077008662_1077008667 -3 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1077008655_1077008667 17 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008667 Original CRISPR TGAACTGTGCCAGTGTTGTG GGG Intronic
901671040 1:10856580-10856602 TGAGCTGGGCCGGTGTTTTGGGG - Intergenic
901886167 1:12224787-12224809 TGAAGTGGGGCAGTCTTGTGGGG - Intergenic
902165094 1:14563713-14563735 TGAACTGTGGCAGGGCTGAGAGG - Intergenic
903203521 1:21763181-21763203 AGAACAATGCCAGTGTTGTGGGG - Intronic
904223068 1:28989448-28989470 AGAACTCTGACAGTGTTGGGGGG + Intronic
904343023 1:29850092-29850114 TTAAGTGTGCGTGTGTTGTGGGG - Intergenic
904495877 1:30886312-30886334 TGAGCTGAGCCAGCTTTGTGGGG - Intronic
906332268 1:44896355-44896377 GGAACTTAGCAAGTGTTGTGGGG + Intronic
906580935 1:46934727-46934749 TGAACTGTGCCACTGGCGGGAGG - Intronic
906602788 1:47144167-47144189 TGAACTGTGCCACTGGTGGGAGG + Intronic
911045463 1:93624077-93624099 TGTACTGTGCCACTGGTGTAGGG + Intronic
911577455 1:99595487-99595509 GCAACTGTGCCGGTGTTCTGAGG + Intergenic
913200446 1:116491872-116491894 TGCACAGTGTCAGGGTTGTGAGG - Intergenic
915713627 1:157924509-157924531 TCAACTGTGCCAGTGAAGAGTGG + Intergenic
917538990 1:175895440-175895462 TGAACTGTGTCAGTGCTCAGTGG + Intergenic
918373244 1:183882469-183882491 TAAACAGTGCCAGAGTTGTATGG + Intronic
921814925 1:219552635-219552657 TGAACGGGGGCAGTCTTGTGGGG + Intergenic
922431279 1:225556847-225556869 TGATCTGTGCCTATGGTGTGAGG + Intronic
922979567 1:229814200-229814222 TGCACTGCCCCAGGGTTGTGTGG + Intergenic
924570599 1:245234535-245234557 AGAACTTTCCCAGTGTGGTGAGG + Intronic
924676790 1:246186846-246186868 GTAACTGTGCCTGTGATGTGGGG - Intronic
1062785431 10:260797-260819 TGTACTGTGCAGGTGTTGTATGG - Intergenic
1065340100 10:24696499-24696521 TGTACTGTGCCTCTGTAGTGGGG + Intronic
1067514005 10:46921031-46921053 AGAACTGCGGAAGTGTTGTGGGG - Intronic
1067648249 10:48130801-48130823 AGAACTGCGGAAGTGTTGTGGGG + Intergenic
1067793806 10:49306636-49306658 TGGGCAGTGCCAGTGATGTGGGG + Intronic
1067816086 10:49477729-49477751 TGAGCTGTGGCAGTGCTTTGGGG - Intronic
1067917125 10:50412082-50412104 TGAATTGTCCCAATGATGTGAGG + Intronic
1068218538 10:54013296-54013318 TGAAATGTCCCACTATTGTGTGG - Intronic
1068265898 10:54649098-54649120 TGAACTGGGCCACTGATGTCAGG + Intronic
1068399939 10:56515325-56515347 TGAACTATGACAGTATTGAGAGG - Intergenic
1069111946 10:64458353-64458375 TGAACTGTGTGTGTGTTGGGTGG - Intergenic
1069285781 10:66713567-66713589 TGTACTGTGACAGTGTTGCCAGG - Intronic
1072846662 10:98838749-98838771 AGCACTGTGCTAGTGATGTGAGG - Intronic
1073457481 10:103646395-103646417 TGGTCTGGGCCAGTGTTGTGGGG - Intronic
1075222550 10:120597831-120597853 TGAGCTGTCACTGTGTTGTGAGG + Intergenic
1077008667 11:370463-370485 TGAACTGTGCCAGTGTTGTGGGG + Intronic
1078159419 11:8827984-8828006 TGGACTGTGGCAATGTTGTGTGG + Intronic
1084925787 11:72510416-72510438 GTAACTGTGGCAGTGTGGTGGGG + Intergenic
1085689939 11:78656589-78656611 AGAACTGTGCCTGTGTCGTCAGG - Exonic
1086923362 11:92612947-92612969 TGTGCTATGCCAGTGTTGGGAGG + Intronic
1087146841 11:94821446-94821468 TCAACAGTGCCAGTATTGTTGGG + Intronic
1087375530 11:97335309-97335331 TGAATTGTGCCAGTAATCTGTGG + Intergenic
1087381405 11:97409104-97409126 GGAACTGTGCTGGTGTTGGGTGG - Intergenic
1089754586 11:120677254-120677276 TGATCTGAGCCTGTGTTGTGTGG + Intronic
1090329483 11:125919781-125919803 TGAATAGTGCCAGTGTAGAGAGG - Intronic
1092526743 12:9314268-9314290 GGAACTGTCCCAGTTCTGTGTGG - Intergenic
1096220200 12:49824305-49824327 TGGACTGTGCCTGTGGCGTGGGG - Intronic
1099556628 12:84116607-84116629 TGCACTTTGCTATTGTTGTGAGG + Intergenic
1099978119 12:89567847-89567869 TGAGCAGTGCCAGAGTTGTGAGG + Intergenic
1100450928 12:94705918-94705940 TGAAATGGGGCAGTCTTGTGGGG - Intergenic
1101790410 12:107921343-107921365 TTAATTGTCCCCGTGTTGTGTGG - Intergenic
1102489511 12:113281419-113281441 ATAACTGTGCCAGTGTAGTTGGG - Intronic
1107568115 13:41627634-41627656 TGCACTGTTCCAGTGTGGAGGGG - Intronic
1107655947 13:42592228-42592250 TGAAGTGGGACAGTCTTGTGGGG - Intronic
1109119714 13:58439255-58439277 AGAACTGAGCCAGGGCTGTGTGG + Intergenic
1110202998 13:72875465-72875487 CGAAATGTGTCAGTGTAGTGTGG + Intronic
1111432451 13:88161581-88161603 TGAACTCTCCCAGTGTGGTTGGG + Intergenic
1114613388 14:24056165-24056187 TGAGCTGTTCCCCTGTTGTGGGG + Intronic
1115563436 14:34603410-34603432 TGAAGTGTTCCTGTGTCGTGTGG - Exonic
1116548130 14:46197544-46197566 TTCTCTGTGCCTGTGTTGTGAGG + Intergenic
1118874645 14:69773385-69773407 TGAACAGTGACAGTGTGGTGTGG - Intergenic
1119234079 14:73005085-73005107 AGAACTGTGCCAGAGAAGTGTGG - Intronic
1120148856 14:81009862-81009884 TCAACTGTGCCAGTTGTGGGGGG + Intronic
1202855026 14_GL000225v1_random:44478-44500 TGCACGGTCCCAGTGTTTTGAGG - Intergenic
1126495922 15:49290541-49290563 AAAACTGGGCCAGTGATGTGTGG - Intronic
1128259331 15:66221544-66221566 TCAGCTGTGCCAGGGCTGTGGGG - Intronic
1131757150 15:95577430-95577452 TGAACTCTGCCATTTTCGTGTGG + Intergenic
1133703128 16:8327707-8327729 TAAAATGTGGCAATGTTGTGGGG - Intergenic
1137344363 16:47641308-47641330 TGACCAGTGCCAGTGTTGCCTGG + Intronic
1138243310 16:55446473-55446495 TTGACTCTGCCAGTGTGGTGGGG - Intronic
1140534660 16:75698729-75698751 TATACTGTGCCTGTGTTGTGTGG - Intronic
1141423818 16:83932997-83933019 TGAGCTCTGCCGGTGTGGTGGGG + Intronic
1141665610 16:85463709-85463731 CTAACTGTGCCAGTGATGCGAGG - Intergenic
1141974014 16:87502326-87502348 TGAAATGTGTGAGTGTCGTGTGG + Intergenic
1143029355 17:3959353-3959375 GGAAGTGTTCCAGTGTGGTGGGG - Intronic
1144662433 17:17079987-17080009 GGGACTGTGCCAGGGATGTGGGG + Intronic
1145182291 17:20763945-20763967 TGAGCTGTGGCAGTGCAGTGTGG - Intergenic
1147595737 17:41715974-41715996 TGGACTGTGTCAGTGTTGTAGGG + Intergenic
1147930489 17:43977515-43977537 TCAGCAGTGCCAGTGTTGGGCGG - Intronic
1150009102 17:61488225-61488247 TGTTCTGTGCCAGGGTTTTGGGG + Intergenic
1150257367 17:63758305-63758327 TGAAGTGGGGCAGTCTTGTGGGG + Intronic
1152840306 17:82563261-82563283 TCAGCTGCTCCAGTGTTGTGGGG + Intronic
1153096370 18:1410161-1410183 TGACCTGTGCTAGAGTTCTGGGG + Intergenic
1157596983 18:48869981-48870003 TGGAGTGTGACTGTGTTGTGTGG + Intergenic
1161248366 19:3267536-3267558 CGCACTGTCCCAGTGTTGGGGGG - Intronic
1161840846 19:6679407-6679429 TGAACTGTGCCGCTGTGCTGAGG - Exonic
1162250468 19:9438533-9438555 TTAACTGTGTTAGTGGTGTGAGG + Intergenic
1164014175 19:21237423-21237445 TGAACTGTTCCTATGTTATGAGG - Intronic
1165864059 19:38925355-38925377 TGAACTGCGTCAGAGTTCTGTGG - Intronic
1166408594 19:42541251-42541273 TGTAGTGTTCCAGTGGTGTGGGG + Intronic
926299349 2:11590893-11590915 TCAACTGTGCCAGTGTGGCCGGG + Intronic
927456550 2:23255264-23255286 TGAATTCTGCCATTGTAGTGTGG - Intergenic
928849144 2:35721093-35721115 TGAAATGTGCCAGAATTCTGGGG - Intergenic
930748774 2:54912080-54912102 TAAACTGTCCCAGTATTGTAAGG + Intronic
933966551 2:87434450-87434472 TGAAGAGTTCCAGTGTAGTGAGG - Intergenic
935697574 2:105783375-105783397 TAAATTGTGCCCGTGTTCTGGGG + Intronic
936327242 2:111516034-111516056 TGAAGAGTTCCAGTGTAGTGAGG + Intergenic
938682385 2:133704931-133704953 TGAAGTGGGGCAGTCTTGTGCGG - Intergenic
939548923 2:143589072-143589094 TGAACTCTGCAAGTTTTCTGAGG - Intronic
940420209 2:153472433-153472455 TTGTCTGTGCCAGTGTTTTGTGG + Intergenic
940572105 2:155450053-155450075 TTAAATGTGCCAATGTTTTGTGG + Intergenic
940641168 2:156345756-156345778 TGGAGTGTGGCAGTGTGGTGGGG - Intergenic
943187528 2:184631561-184631583 TGGTCAGTGCCAGTGTTGTCCGG - Intronic
944539143 2:200740197-200740219 TGGGCTGTGTCAGTGTTCTGAGG - Intergenic
946092901 2:217246545-217246567 GGACCTGTGCCAGTGGTGGGTGG - Intergenic
946261278 2:218493425-218493447 TACACTGTGCCAGTGGTGTTAGG - Intronic
948402475 2:237693665-237693687 TGAGCGGTGCCAGTGTTCTGAGG + Intronic
948494008 2:238333522-238333544 GGAACTGTGCCAGTGGAGGGAGG + Intronic
948781944 2:240327123-240327145 AGAACTTTGCCAGTGCTGCGGGG - Intergenic
1172160653 20:32865829-32865851 TGACTGGTGCCAGTGTTGGGAGG + Intronic
1173047209 20:39523953-39523975 ACAATGGTGCCAGTGTTGTGAGG - Intergenic
1174457574 20:50660592-50660614 TCCACTGTGGCAGTGTTGGGAGG - Intronic
1176946025 21:14982676-14982698 TGTACTTTGCCATTATTGTGGGG + Intronic
1179891047 21:44335283-44335305 TGACCTGTGCCCGTCTTCTGGGG - Intronic
1180913746 22:19471079-19471101 AGAACTGTGCCAGTGCTGTAGGG - Intronic
1183405322 22:37627691-37627713 AGAACTATGCCAGTGCAGTGCGG - Intronic
951686264 3:25348035-25348057 TCACCTGTTCCAGTCTTGTGTGG + Intronic
952306878 3:32154641-32154663 TGCCCTGTGACAATGTTGTGAGG + Intronic
953174267 3:40535266-40535288 TAAACAGTGCCAGTGTTTTAAGG + Exonic
954457924 3:50610053-50610075 TGTGGTGTGCCAGAGTTGTGTGG - Intronic
954735968 3:52706556-52706578 TACCCTGTGCCAGAGTTGTGAGG + Intronic
956219162 3:66883877-66883899 TGCACTGTGCCAAGGGTGTGGGG - Intergenic
956874017 3:73444323-73444345 TGCACTGTGCCAGTTTCTTGAGG + Intronic
957281432 3:78155370-78155392 TCAACTGTGCCAGTGGTGTTGGG - Intergenic
958460805 3:94392336-94392358 TTAACTCTGCCATTGTAGTGTGG + Intergenic
958563095 3:95773811-95773833 TTAACTAGGCCAGTGTTGAGAGG + Intergenic
959787778 3:110321220-110321242 TGAATTGTGACAATGTTTTGGGG + Intergenic
961028419 3:123581397-123581419 TAGACTATGCCAGTGATGTGAGG - Intronic
961425173 3:126839632-126839654 TGAACTGAGGCTGGGTTGTGGGG - Intronic
967822791 3:193853793-193853815 TGAACTGGGCCTGTGGTGTGGGG - Intergenic
968679050 4:1903472-1903494 TGAACCATCCCAGTGTGGTGAGG - Intronic
972481759 4:39503415-39503437 AGCACTGTGCCAGTGCTGTGAGG - Intronic
974767543 4:66366931-66366953 TAATATGTGACAGTGTTGTGTGG + Intergenic
975715261 4:77199438-77199460 TGACCTGTGTCAGAGCTGTGGGG + Intronic
980612265 4:135174347-135174369 TAAACTGTGAAAATGTTGTGTGG + Intergenic
981849371 4:149210606-149210628 TGAAATGTGGCAGTGTTGAGAGG - Intergenic
987106724 5:14646988-14647010 TGAACTGGTCCAGGGTTGAGGGG + Intergenic
988780194 5:34513584-34513606 TGAATTGTGCCAGCATTTTGGGG + Intergenic
990172960 5:53075545-53075567 TGGAGTGTGCCTGTGATGTGTGG - Intronic
992863171 5:80932699-80932721 AGAACTTTGACAGTGATGTGGGG - Intergenic
993768771 5:91896992-91897014 TGAACTGTACCCTTGTTTTGAGG + Intergenic
994225743 5:97249958-97249980 TGAATTGTGGCAGCATTGTGTGG - Intergenic
996487206 5:124050563-124050585 GGAACTCTGCCAGAGTTGAGAGG + Intergenic
996642909 5:125778688-125778710 TTAACTTTGCCTGTGTTTTGAGG - Intergenic
998049735 5:139022365-139022387 TTGACTGTGCTAGTGTTTTGTGG + Intronic
999974104 5:156893798-156893820 TCAAGTATGCCAGTGTTGGGAGG - Intergenic
1004557798 6:16716537-16716559 TGAATTGTGGCAGGGTTGTGGGG + Intronic
1006153410 6:32001388-32001410 TGAAGTCTGCCAGTGTGCTGAGG + Exonic
1006159718 6:32034125-32034147 TGAAGTCTGCCAGTGTGCTGAGG + Exonic
1006884992 6:37374041-37374063 TGAACCCTGCCAGTGTTTTCTGG - Intronic
1007124446 6:39413567-39413589 TGACTTTTGCCAGTGTTGTTGGG + Intronic
1011033088 6:82943772-82943794 TGAGCTGTGCAGGTGCTGTGGGG - Intronic
1013722685 6:113049623-113049645 TGAATTGTGCCAGGATTGTTGGG - Intergenic
1023037502 7:36146067-36146089 TGAAAGGTGTCAGTTTTGTGTGG - Intergenic
1024331598 7:48160639-48160661 TGAGCTGAGCCAGTTGTGTGTGG - Intergenic
1024564986 7:50673504-50673526 TGAATTTTGCCAGGGCTGTGAGG - Intronic
1024688750 7:51776737-51776759 TGTGCTGTGCATGTGTTGTGTGG + Intergenic
1030026227 7:105327356-105327378 TTAACTCTGCCATTGTAGTGTGG - Intronic
1036168759 8:6462994-6463016 TGGACTGTCCCAGAGTTTTGAGG - Intronic
1041553385 8:59125268-59125290 TGAAATCTTCCAGGGTTGTGTGG + Intergenic
1045964804 8:108012913-108012935 TGATCTGTGCCAGGTTTGTGTGG - Intronic
1048308932 8:133303351-133303373 TGACCTGTGTCACTGTTGGGTGG + Intergenic
1049269327 8:141685922-141685944 TGAACTGTTCCAGTGTGGAAGGG + Intergenic
1049586976 8:143436796-143436818 TGAGCTGAGCCAGTGTTGGAGGG + Intergenic
1051969028 9:22864330-22864352 TGAATTGTCCTAGTGTTTTGTGG - Intergenic
1053054630 9:34987372-34987394 TGGACTGTGACAGTGTGGTCTGG - Intergenic
1054827812 9:69590489-69590511 TGCTCAGTGCCAGTGCTGTGAGG - Intronic
1055936208 9:81606839-81606861 TGAACTTTGCCATTGTTGCCAGG - Intronic
1062368210 9:136222227-136222249 TGACCAGTATCAGTGTTGTGGGG - Intronic
1187018577 X:15355756-15355778 TGAACTGTGCATGTTTTATGGGG + Intronic
1187172638 X:16867237-16867259 TGAACTGGGGCCGTGTTGTCTGG - Intronic
1187699023 X:21946973-21946995 TGAACTGAGCCTGTGGTTTGAGG + Intronic
1194940966 X:100009602-100009624 TGATCTGTTCCAGGGTAGTGTGG - Intergenic
1194960593 X:100230943-100230965 TCAACTCTGCCATTGTAGTGTGG + Intergenic
1195280094 X:103324019-103324041 TGATCTGTGTCAGTTTTGAGTGG - Intergenic
1195520278 X:105822166-105822188 TGGACTGTGGCAGGGCTGTGGGG + Intergenic
1198801354 X:140450978-140451000 TTATCAGTGCCAGGGTTGTGTGG - Intergenic
1199835662 X:151587603-151587625 TGACCTGAGCCAACGTTGTGAGG - Intronic