ID: 1077008668

View in Genome Browser
Species Human (GRCh38)
Location 11:370464-370486
Sequence GAACTGTGCCAGTGTTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008668 -2 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157
1077008655_1077008668 18 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157
1077008663_1077008668 -3 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG 0: 1
1: 0
2: 2
3: 21
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008668 Original CRISPR GAACTGTGCCAGTGTTGTGG GGG Intronic
900215519 1:1479560-1479582 TATGTGTGCCTGTGTTGTGGCGG - Intronic
901435780 1:9246583-9246605 GAACTGGGCCAGTCCTGGGGAGG + Intronic
901671039 1:10856579-10856601 GAGCTGGGCCGGTGTTTTGGGGG - Intergenic
904408528 1:30311088-30311110 GTCCTGTGCCAGTGCTGAGGTGG + Intergenic
906332269 1:44896356-44896378 GAACTTAGCAAGTGTTGTGGGGG + Intronic
906602789 1:47144168-47144190 GAACTGTGCCACTGGTGGGAGGG + Intronic
908413172 1:63886785-63886807 GATTTGTGCCAGTGTGGAGGTGG - Intronic
911045464 1:93624078-93624100 GTACTGTGCCACTGGTGTAGGGG + Intronic
911129645 1:94375532-94375554 AAGCTGTGCCAGTGTTCAGGAGG + Intergenic
911577456 1:99595488-99595510 CAACTGTGCCGGTGTTCTGAGGG + Intergenic
912139108 1:106699773-106699795 GAAATCAGGCAGTGTTGTGGTGG - Intergenic
916180281 1:162077693-162077715 TAACTGTGCCAGGGTGGGGGTGG - Intronic
917167421 1:172127949-172127971 TAGCTATGCCAGTGTGGTGGTGG - Intronic
920371544 1:205482239-205482261 GAACTGTCCCAGTGTTGGGGTGG + Intergenic
921153002 1:212416513-212416535 GCACTGTTCCAGTGGAGTGGAGG - Intergenic
921337174 1:214099970-214099992 GAACAGTGCCAGGCTTCTGGTGG - Intergenic
922093340 1:222418905-222418927 GAACTGTGCCAGGTCTGTGAAGG - Intergenic
1068404823 10:56574937-56574959 AAACTGTGCCAGTGTCCAGGAGG + Intergenic
1069783189 10:70969598-70969620 TAGCTGAGCCAGTGTAGTGGGGG + Intergenic
1070766589 10:79060145-79060167 GACCTCTGCCAGTGGTGTGCTGG - Intergenic
1072568553 10:96638772-96638794 AAACTGTGACAGTGCTGTGGAGG - Intronic
1076272176 10:129163235-129163257 GCACTGTGCCAGAGCAGTGGTGG - Intergenic
1077008668 11:370464-370486 GAACTGTGCCAGTGTTGTGGGGG + Intronic
1077061451 11:619492-619514 CGCCTGTGCCAGTGTGGTGGTGG + Exonic
1078911730 11:15739078-15739100 GAGCTGGGCCTGTGTTGGGGTGG + Intergenic
1080481486 11:32655783-32655805 TAACTCTGGCAGTGTTGTGGAGG + Intronic
1083177065 11:60957052-60957074 AAACAGGGGCAGTGTTGTGGGGG - Intergenic
1083182486 11:60996223-60996245 GAGCTGTGCCAGATTTGTGACGG + Intronic
1083662484 11:64258223-64258245 GAGCTGTGCCAGGGCTGAGGTGG + Intronic
1084925788 11:72510417-72510439 TAACTGTGGCAGTGTGGTGGGGG + Intergenic
1085689938 11:78656588-78656610 GAACTGTGCCTGTGTCGTCAGGG - Exonic
1087146842 11:94821447-94821469 CAACAGTGCCAGTATTGTTGGGG + Intronic
1087381404 11:97409103-97409125 GAACTGTGCTGGTGTTGGGTGGG - Intergenic
1089754587 11:120677255-120677277 GATCTGAGCCTGTGTTGTGTGGG + Intronic
1089774994 11:120829855-120829877 CATCAGTGCCACTGTTGTGGGGG + Intronic
1093093019 12:14942406-14942428 GAAATGTGGCAGTGTTGAAGAGG + Exonic
1093093933 12:14951381-14951403 GAACTATGCAAGTGTTTTAGGGG - Intronic
1094383849 12:29872633-29872655 GAACTATACCAATGGTGTGGAGG + Intergenic
1096485739 12:51979774-51979796 GAATTCTGGCAGTGGTGTGGAGG + Intronic
1096672812 12:53210420-53210442 GAAGTGTGCCTGGATTGTGGTGG - Intergenic
1101312099 12:103590414-103590436 GCACTGTGCCAGTGCCGTGGAGG - Intronic
1101434157 12:104650837-104650859 GAACCTTGCCAGTGTGGAGGTGG + Intronic
1102517318 12:113458485-113458507 GCACTGTGCTAGTGTTGGGGTGG + Intergenic
1102870264 12:116408706-116408728 GACCTCTGCCAGTGGGGTGGAGG + Intergenic
1102939669 12:116928369-116928391 GACCTGTGGCAGTGTGCTGGTGG + Intronic
1104438645 12:128777017-128777039 GAAATTAGCCAGTGTTGAGGAGG - Intergenic
1106780375 13:33053158-33053180 GAACTGTCCCAGAGTTCTGGAGG + Intronic
1107284870 13:38779728-38779750 GAACTGTTCCAGTGAAGTAGAGG - Intronic
1108328066 13:49354717-49354739 GAACTGTGTCAGTGTGGAGAAGG + Intronic
1109092638 13:58068578-58068600 GAAGTGTGCCAGTGCTGCAGTGG - Intergenic
1109491039 13:63100565-63100587 GAAGTGTCCCAGTGTTGTGAAGG - Intergenic
1109535042 13:63705379-63705401 GAACTGTACCAGTTTTTAGGAGG + Intergenic
1109922080 13:69077926-69077948 GAACTGTGACAGTGTTCAAGAGG - Intergenic
1110202999 13:72875466-72875488 GAAATGTGTCAGTGTAGTGTGGG + Intronic
1114613389 14:24056166-24056188 GAGCTGTTCCCCTGTTGTGGGGG + Intronic
1117757633 14:58992066-58992088 GAACTGTACCAGTGTTCTCTTGG - Intergenic
1118874644 14:69773384-69773406 GAACAGTGACAGTGTGGTGTGGG - Intergenic
1122679838 14:103451012-103451034 GGCCTGAGCCAGTGTGGTGGAGG - Intronic
1125404453 15:39337978-39338000 GAGCTGTGACAGTGGTGTGCTGG - Intergenic
1126432613 15:48602136-48602158 GAACTGTGTGTGTGTTGTGTTGG - Intronic
1126495921 15:49290540-49290562 AAACTGGGCCAGTGATGTGTGGG - Intronic
1129305104 15:74654636-74654658 GAACTGTGTCAGTCTTTTGCTGG - Intronic
1129961346 15:79688468-79688490 GAACTGGGATAGTGTGGTGGTGG - Intergenic
1133961023 16:10493468-10493490 GATGTGTGGCAGTATTGTGGTGG + Intergenic
1138243309 16:55446472-55446494 TGACTCTGCCAGTGTGGTGGGGG - Intronic
1138702723 16:58881276-58881298 GAACTGTGAAATTCTTGTGGAGG + Intergenic
1141929220 16:87190193-87190215 GAACTGTGGCAGTGATGAGTTGG + Intronic
1143029354 17:3959352-3959374 GAAGTGTTCCAGTGTGGTGGGGG - Intronic
1147615065 17:41822719-41822741 CAGCTGTGTCAGTGATGTGGAGG - Exonic
1147656783 17:42095628-42095650 AAATTGTCCCAGTTTTGTGGTGG + Intergenic
1152017422 17:77760951-77760973 GAAGGGTGGCAGTGATGTGGGGG + Intergenic
1152996042 18:407121-407143 GCCCTGTGTCAGTGTTGAGGTGG + Intronic
1153096371 18:1410162-1410184 GACCTGTGCTAGAGTTCTGGGGG + Intergenic
1154347083 18:13551254-13551276 CAGCTGTCCCAGGGTTGTGGGGG - Intronic
1162794393 19:13079023-13079045 GAACTGGGCCAGAGTTGGGGAGG - Intronic
1163008580 19:14411094-14411116 GAACTGTCCCCATGTCGTGGTGG - Exonic
1164305730 19:24002902-24002924 GGGCTGTGCCAGTGGTCTGGCGG - Intergenic
1164434316 19:28216100-28216122 GCACTGTACCAGTGTTGGAGTGG - Intergenic
1165823087 19:38689447-38689469 TAACTGTACCAGTTTTGCGGTGG + Intronic
1166408595 19:42541252-42541274 GTAGTGTTCCAGTGGTGTGGGGG + Intronic
1167278793 19:48554351-48554373 GATCTGAGCCAGTGATGGGGAGG - Intronic
1167921161 19:52784466-52784488 GAAGTGGGACAGTGATGTGGGGG - Intronic
925906735 2:8544290-8544312 GAACAGTGCTGGTGTTGAGGTGG + Intergenic
926012786 2:9422343-9422365 GAACTGTGCCCGGGTTGTGGAGG - Intronic
928989627 2:37218926-37218948 GAAATGTGCCAGTGTTTGGAAGG - Intronic
929080826 2:38120515-38120537 GCACTGTGCCAGGGCAGTGGGGG - Intergenic
934151106 2:89148368-89148390 GAACAGAGCCTGTGCTGTGGTGG + Intergenic
934216155 2:90033539-90033561 GAACAGAGCCTGTGCTGTGGTGG - Intergenic
935218785 2:100994618-100994640 GAACAGTGGGAGTGCTGTGGTGG + Intronic
938792007 2:134684771-134684793 AAAATTTGCCAGTGTGGTGGTGG + Intronic
945419677 2:209619111-209619133 GAGCTGTGGCAGTGATGTTGGGG + Intronic
945473568 2:210255269-210255291 TAATTGTGGCTGTGTTGTGGAGG + Intergenic
946092900 2:217246544-217246566 GACCTGTGCCAGTGGTGGGTGGG - Intergenic
1170702017 20:18712375-18712397 GTACTGTGTGTGTGTTGTGGGGG + Intronic
1171107866 20:22452779-22452801 GAACAGTGCCAGTGTGTTAGTGG + Intergenic
1173309482 20:41884333-41884355 GGAGTGTGCCAGTGTATTGGAGG - Intergenic
1178326091 21:31646653-31646675 GAACTGTGGCAGGGATTTGGGGG + Intergenic
1179540385 21:42079751-42079773 GAACTGTGCCATGGTGGTGGAGG - Intronic
1180700639 22:17779764-17779786 GCACTGAGCCAGTGGTATGGGGG - Intergenic
1181200420 22:21213937-21213959 GAACTGCACCAGTGGTGTTGGGG + Intronic
1181769618 22:25115924-25115946 AAAATTAGCCAGTGTTGTGGAGG - Intronic
1183290320 22:36998078-36998100 GAACTGTGCCAAGGGTGTGCTGG - Intronic
1183405321 22:37627690-37627712 GAACTATGCCAGTGCAGTGCGGG - Intronic
1184396514 22:44245092-44245114 TGACTGTCCCAGTGCTGTGGGGG + Exonic
949526313 3:4908106-4908128 AAACAGTGCCAGTGTTGGGGTGG + Intergenic
950019584 3:9777765-9777787 GAACAGAGACAGTTTTGTGGAGG - Intronic
950962119 3:17118217-17118239 TATCTCTGCCAGTGCTGTGGAGG - Intergenic
951752563 3:26053984-26054006 GCACTGTGCCAGTGCTATGGAGG + Intergenic
952520326 3:34150395-34150417 GCACTGTTCCAGTGATGTGTTGG + Intergenic
956219161 3:66883876-66883898 GCACTGTGCCAAGGGTGTGGGGG - Intergenic
956733130 3:72214899-72214921 GAATTATGACAGGGTTGTGGGGG - Intergenic
958269047 3:91475845-91475867 GAACTGTACCAGTGTAATTGTGG - Intergenic
960410531 3:117318028-117318050 AAACTGTGCCAGTTTGGAGGAGG - Intergenic
962094880 3:132283455-132283477 GAACAGTGCCTGTGGAGTGGTGG - Intronic
962530580 3:136276687-136276709 CAACTGTGTCTGTGTAGTGGTGG + Intronic
963967614 3:151390209-151390231 GAAATGTCCAAGTTTTGTGGAGG - Intronic
967822790 3:193853792-193853814 GAACTGGGCCTGTGGTGTGGGGG - Intergenic
968229194 3:196994640-196994662 GAGCTGTGCCTGTGTAGGGGCGG - Intronic
969142606 4:5092380-5092402 GAACTAGCCCAGCGTTGTGGTGG + Intronic
969980576 4:11150088-11150110 GAACTTCACCAGTGTTGTGCAGG + Intergenic
971830043 4:31680216-31680238 CAACTGTGCCATTGTGGTGGTGG + Intergenic
972481758 4:39503414-39503436 GCACTGTGCCAGTGCTGTGAGGG - Intronic
983936527 4:173506658-173506680 GAACTGAGGCGGGGTTGTGGAGG + Intergenic
984471959 4:180187832-180187854 GAACTGTGGCAGTATTGTCTTGG + Intergenic
992863170 5:80932698-80932720 GAACTTTGACAGTGATGTGGGGG - Intergenic
993158143 5:84254087-84254109 CAACTGTTCTAGTGTTGTGGAGG - Exonic
994387893 5:99153609-99153631 CAACTGTGCTATTGGTGTGGAGG - Intergenic
996487207 5:124050564-124050586 GAACTCTGCCAGAGTTGAGAGGG + Intergenic
997970381 5:138396670-138396692 GAAGTGTGGTAGTGTCGTGGTGG + Intronic
998103781 5:139455582-139455604 GTATTGTGCCAGGGTTGAGGTGG + Intronic
999254829 5:150204512-150204534 GAACTGTGCTTGTGTTTTAGGGG + Exonic
1004557799 6:16716538-16716560 GAATTGTGGCAGGGTTGTGGGGG + Intronic
1006374558 6:33664777-33664799 CAGCTGTGGCAGTGTTGGGGAGG + Intronic
1007164435 6:39819030-39819052 CAATTCTGCCAGTTTTGTGGAGG - Intronic
1008986183 6:57545892-57545914 GAACTGTACCAGTGTAATTGTGG + Intronic
1009166070 6:60342792-60342814 GATATGTGTCACTGTTGTGGTGG + Intergenic
1009174141 6:60438447-60438469 GAACTGTACCAGTGTAATTGTGG + Intergenic
1009697096 6:67120599-67120621 AAAATGTGCCAGTGTTATGGAGG - Intergenic
1010636250 6:78261949-78261971 TAACTTTGCCACTGATGTGGGGG - Intergenic
1011033087 6:82943771-82943793 GAGCTGTGCAGGTGCTGTGGGGG - Intronic
1013559216 6:111287700-111287722 GATGTGTGGCAGTATTGTGGTGG - Intergenic
1013611269 6:111798277-111798299 GACATGTGCCAGTGTGGTTGAGG - Intronic
1013857017 6:114585170-114585192 CTTCTGTGCCAGTTTTGTGGAGG - Intergenic
1018442405 6:163825242-163825264 GAATTGTGCCAGAGCTGTTGGGG + Intergenic
1018850322 6:167583784-167583806 GAACTCTGCCACTATAGTGGTGG + Intergenic
1020073713 7:5243801-5243823 AGACTGTGTCAGTGTTCTGGGGG + Intergenic
1021656779 7:22881048-22881070 GCACTGTTTCAGTGTTGGGGTGG - Intergenic
1022334231 7:29407310-29407332 CAACTGTGCCACTGTGGAGGGGG + Intronic
1023336367 7:39174903-39174925 GAACAGTGCCATTGTGATGGTGG - Intronic
1024147360 7:46531206-46531228 GAACTGGGCCAGTGGTGTTCAGG - Intergenic
1029780923 7:102731552-102731574 CAAATGTGCCACTGTGGTGGAGG - Intergenic
1032137570 7:129294642-129294664 GAACAGCTACAGTGTTGTGGTGG - Intronic
1032655757 7:133928250-133928272 CACCTGTGCCATTGTGGTGGTGG + Intronic
1033248531 7:139738965-139738987 GCACTGTGCCATGGGTGTGGAGG - Intronic
1033316492 7:140301730-140301752 ACACTGTGCCAGGATTGTGGGGG + Intronic
1035041997 7:155935825-155935847 GCAAAGTGCCAGTGTTGTCGGGG + Intergenic
1036019188 8:4823744-4823766 AAACTTAGCCAGTGTGGTGGTGG + Intronic
1036531945 8:9598610-9598632 CAACTGAGCCAGTGATGCGGAGG + Intronic
1036626193 8:10474204-10474226 GAAATGTCCTAGTGTTGGGGTGG - Intergenic
1037021838 8:13982451-13982473 GAATTGTACCACTGTGGTGGGGG + Intergenic
1037100159 8:15033610-15033632 GAACTGTCCCGATGCTGTGGTGG - Intronic
1039203963 8:35128965-35128987 GTACTTTGCCAGAGTGGTGGTGG - Intergenic
1040857345 8:51961689-51961711 GAACTGTGTCATGGTTCTGGAGG + Intergenic
1042497755 8:69474040-69474062 TAAATGTGCCAGTGTTGTTCAGG - Intronic
1045362756 8:101448487-101448509 GAAGTGTGACTGTGCTGTGGAGG + Intergenic
1045964803 8:108012912-108012934 GATCTGTGCCAGGTTTGTGTGGG - Intronic
1049586977 8:143436797-143436819 GAGCTGAGCCAGTGTTGGAGGGG + Intergenic
1050899713 9:10931379-10931401 CAACTGGGCCGGTGTTGTTGAGG + Intergenic
1051188495 9:14485908-14485930 GGACTGTGTGTGTGTTGTGGGGG - Intergenic
1053013443 9:34648261-34648283 GAAATATGCCAATGATGTGGAGG + Intronic
1053531643 9:38887957-38887979 CAAATGGGCCATTGTTGTGGTGG - Intergenic
1054203867 9:62112385-62112407 CAAATGGGCCATTGTTGTGGTGG - Intergenic
1054634495 9:67475980-67476002 CAAATGGGCCATTGTTGTGGTGG + Intergenic
1062368209 9:136222226-136222248 GACCAGTATCAGTGTTGTGGGGG - Intronic
1062538421 9:137030971-137030993 GCACTGTGCCAGTGGTGCTGGGG - Exonic
1185891129 X:3822981-3823003 GAAGTGTGTCAGTGTTGTGATGG + Intronic
1186394029 X:9189747-9189769 AAACTGTGACACTGCTGTGGCGG - Intergenic
1188411435 X:29876724-29876746 TAACTGTGCCAAATTTGTGGAGG - Intronic
1193748635 X:85315001-85315023 AAGCTGTTTCAGTGTTGTGGTGG - Intronic
1196867971 X:120086594-120086616 GAACTGTGCTACTATTGTAGGGG - Intergenic
1196875132 X:120149687-120149709 GAACTGTGCTACTATTGTAGGGG + Intergenic