ID: 1077008669

View in Genome Browser
Species Human (GRCh38)
Location 11:370472-370494
Sequence CGCATGGACCCCCACAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008669_1077008676 -2 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008676 11:370493-370515 CGTAGGGATGGGGCCCAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1077008669_1077008678 0 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008678 11:370495-370517 TAGGGATGGGGCCCAGCTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1077008669_1077008679 7 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008679 11:370502-370524 GGGGCCCAGCTTGGGGAGCCTGG 0: 1
1: 0
2: 2
3: 47
4: 435
1077008669_1077008677 -1 Left 1077008669 11:370472-370494 CCAGTGTTGTGGGGGTCCATGCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077008677 11:370494-370516 GTAGGGATGGGGCCCAGCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008669 Original CRISPR CGCATGGACCCCCACAACAC TGG (reversed) Intronic