ID: 1077008670

View in Genome Browser
Species Human (GRCh38)
Location 11:370476-370498
Sequence TGTTGTGGGGGTCCATGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008670 10 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008655_1077008670 30 Left 1077008655 11:370423-370445 CCGGTGCAGCTGGGACGCTTCCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008664_1077008670 -3 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1077008663_1077008670 9 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008670 Original CRISPR TGTTGTGGGGGTCCATGCGT AGG Intronic
901460469 1:9388233-9388255 TGTTCTGGGGGGCTTTGCGTGGG - Intergenic
902332910 1:15739316-15739338 TGGTGTGGGGGCCCAGGCGCAGG - Exonic
903684103 1:25118725-25118747 TGTTGTGGGTGTTCAAACGTAGG + Intergenic
906850596 1:49245678-49245700 TTTTTTGGGGGTCCATTAGTAGG + Intronic
911008610 1:93254252-93254274 TGTTGTGGGGGAATATGAGTGGG + Intronic
918323299 1:183384944-183384966 TGTTTTGGGAGTCCAGGGGTGGG + Intronic
1070639650 10:78158503-78158525 GGTTGTGGGTGTCCATCCCTAGG + Intergenic
1073117540 10:101100233-101100255 TGTTGTGGGGGTGCAAGTGGGGG - Intronic
1076106427 10:127827206-127827228 TGCTGTGGGTGTCCAGGCATGGG + Intergenic
1077008670 11:370476-370498 TGTTGTGGGGGTCCATGCGTAGG + Intronic
1079133598 11:17763534-17763556 TGGTGTGGGGGTCTGTGTGTGGG - Intronic
1084204191 11:67582077-67582099 TGTTTTGGGGGTACATGTGAAGG + Intergenic
1084279493 11:68078142-68078164 TGTTTTGGGGGTGTATGCGAGGG - Intronic
1090826955 11:130394309-130394331 TGATGTGGAGGTCAAGGCGTAGG + Intergenic
1091352108 11:134906055-134906077 CGCTGTGGGGGTCCCTGCGAAGG + Intergenic
1099368936 12:81806286-81806308 TGTTGTGGGTGTGCATGAGTAGG + Intergenic
1101450034 12:104767693-104767715 TGTTGTGGGGATCTATCCATAGG - Intergenic
1104753684 12:131255723-131255745 TGCTGTGGAGGTCCAGGGGTGGG - Intergenic
1105707344 13:22976621-22976643 TGATGTGGGGGCCCCTGCTTTGG + Intergenic
1113346780 13:109485947-109485969 GCTTGTAGGGGTCCATGCTTGGG - Intergenic
1115395900 14:32908067-32908089 CGTTGTGGGGGGCCATGGATTGG - Intergenic
1119048597 14:71343737-71343759 TGTTGTGGGGGACCATGCTGTGG + Intronic
1122921141 14:104880718-104880740 TGGTGTGGGTGTGCATGAGTAGG - Intronic
1126583317 15:50260453-50260475 TGTTGTGTGGGTGGAGGCGTGGG + Intronic
1128028731 15:64461001-64461023 TGTAGGGGGGGTCGTTGCGTGGG + Intronic
1131621299 15:94070893-94070915 TGCTGTGGGGGACCGTGCCTTGG + Intergenic
1131827835 15:96334227-96334249 TGTTGTTGGGCTGCATGCATTGG - Exonic
1132910616 16:2308828-2308850 TGGTGTGGGGGTCCCTGGGATGG - Intronic
1133735640 16:8613220-8613242 TATTGTGAGGGTGCATGCTTAGG + Intergenic
1141649022 16:85382772-85382794 TGTTGTGTGTGTGCATGCATGGG - Intergenic
1146687316 17:34849707-34849729 TGTTGTGGGGGTGCAGGGATGGG - Intergenic
1147215344 17:38896041-38896063 TGCTGTGGGGGTCCCTGTGGAGG - Intronic
1148243277 17:46013721-46013743 CGCTGTGAGGGTCGATGCGTGGG - Intronic
1150656803 17:67044768-67044790 TGTTGTGGTGCTCCATGTGGGGG - Exonic
1153414898 18:4835870-4835892 TGTTGTGGGTGTTCATGCCCGGG - Intergenic
1156352276 18:36311666-36311688 TGTGGTGGGGGTGCAGGTGTGGG - Intronic
1157576923 18:48749861-48749883 TGTAGTGAGGGTCCATGGGCCGG + Intronic
1157608128 18:48939153-48939175 TGTTGTGGGGGTGGGTGTGTGGG - Intronic
1161949817 19:7461795-7461817 GGTTGTGGTGGTGCATGCCTGGG - Intronic
1163697397 19:18770850-18770872 GGGTGTGGGTGTGCATGCGTGGG + Intronic
1164691532 19:30214252-30214274 TGTTGTGGGGGTACATTCAGGGG + Intergenic
929939429 2:46321687-46321709 TGTTGTGGGGGTGCGGGGGTGGG - Intronic
944546284 2:200802201-200802223 GGTTGAGGGGGTCCATGTGCAGG - Intergenic
947354960 2:229282557-229282579 TGTTGTGAGGATCCAAGCGGTGG - Intergenic
1170050001 20:12131826-12131848 TTTTGTGGGGGTACATACGTAGG - Intergenic
1171071460 20:22072622-22072644 TGTGATGGGGGACCCTGCGTGGG + Intergenic
1171230549 20:23480698-23480720 TGTGGTGGGGGGACATGCATTGG + Intergenic
1175844343 20:62050827-62050849 TGTTCTGGGGGGCCAGGTGTGGG - Intronic
1180701210 22:17782266-17782288 CGGTGTGGGGGTCCCGGCGTGGG + Intergenic
1180744779 22:18079901-18079923 TGTTGTGGGGATCCAGGCCCTGG + Exonic
1181050820 22:20237500-20237522 TGTTGGGAGGGTGCATGTGTCGG - Intergenic
1181558036 22:23683352-23683374 TGGTGTGGGGGACAATGCCTGGG + Intergenic
1182771186 22:32797412-32797434 TGTTGTGGGGATACATGGGAGGG + Intronic
1184924621 22:47628246-47628268 TGTTGTGGGGGTGTGTGTGTGGG + Intergenic
962879317 3:139561204-139561226 TGTTGTGCTGGTGCATCCGTAGG + Exonic
963371954 3:144412303-144412325 TGTTGTGCAGGCCTATGCGTGGG + Intergenic
964807927 3:160631809-160631831 TGTTGTGGGGGCACAGGGGTAGG + Intergenic
968876185 4:3269117-3269139 CGTTGTGGAGGTCCATGAGGAGG + Intronic
968919826 4:3516798-3516820 TGTTGCGGGGCTCCATGGGCAGG - Intronic
969559591 4:7939012-7939034 TGTAATGGGGGTCCGTGCGCGGG - Exonic
972335751 4:38106212-38106234 TGTTGTGAGGGCCCATGAGATGG - Intronic
974335547 4:60539834-60539856 TGGTGTGGGCTTCCATGCATGGG + Intergenic
975421822 4:74173502-74173524 TGTTGTCCGGGGCCATGCCTGGG + Intronic
976424548 4:84886775-84886797 TGTTGTTGGAGACCATGGGTAGG - Intronic
977557146 4:98497813-98497835 TGTTATGGGGGTGCATGGGGAGG + Intronic
977800718 4:101227586-101227608 TGTTTTAGGGGTACATGTGTAGG + Intronic
979978411 4:127224920-127224942 TGTGGTGTGGGTTCATGAGTGGG + Intergenic
985379646 4:189379213-189379235 TCATATGGGAGTCCATGCGTGGG + Intergenic
986255957 5:6101565-6101587 GGTTGGGGAGGTCCATGCGGTGG - Intergenic
986432277 5:7693099-7693121 TGTTGTGGGGGGCATTGTGTGGG - Intronic
1001101358 5:168817234-168817256 TGTTGTGGGAGCTCATGGGTGGG + Intronic
1004284652 6:14309998-14310020 TGTTGTGGGGGTCATTTTGTTGG - Intergenic
1006020678 6:31115993-31116015 TGTTGTGTGTGTGCATGCCTTGG - Exonic
1007678877 6:43620921-43620943 TGTTGTGCTGGCCCAGGCGTGGG - Exonic
1007963268 6:45980537-45980559 TGTTTTGGGGGTACATGTGCTGG - Intronic
1012979316 6:105813001-105813023 TATTTTGGGGGTCCATGTGCAGG - Intergenic
1017908528 6:158773182-158773204 GGTTGTGGGGGTGCATGGGTGGG + Intronic
1019285922 7:222981-223003 TGCTGTGTGGGTGCATGTGTGGG + Intronic
1019487233 7:1294931-1294953 TGTGGTGTGGGTGCATGGGTGGG + Intergenic
1019742442 7:2681577-2681599 TGTTGTTGGGGTCCAACTGTGGG + Intronic
1033244071 7:139704064-139704086 TGTGGAGGGGGTGCATGTGTTGG - Intronic
1033244136 7:139704398-139704420 TGTGGAGGGGGTGCATGTGTTGG - Intronic
1034167380 7:149036209-149036231 TGTTGAGGGGGTACATGTGCAGG - Intergenic
1035226171 7:157433865-157433887 GGGTGTGGGGGTGCATGTGTGGG - Intergenic
1038081648 8:24144060-24144082 TGTTTTGGGGGTATATGAGTTGG + Intergenic
1040481716 8:47832994-47833016 TGCTGTGGAGCTCCATACGTGGG - Intronic
1044066500 8:87705777-87705799 TATAGTGGGGGTACAGGCGTTGG + Intergenic
1046591110 8:116208519-116208541 TGTTTTGGGGGTACATGTGCTGG - Intergenic
1046947849 8:119991141-119991163 TGGTTTGGGGGTACATGCGAAGG + Intronic
1048497364 8:134946372-134946394 TGGTGTGGAGGTCCCTGGGTAGG + Intergenic
1052840587 9:33288973-33288995 TGTTGTGGGGGTCAGTGCCACGG + Intergenic
1056806114 9:89730204-89730226 TGGTGTGGGGGGGCATGTGTAGG + Intergenic
1057276719 9:93680100-93680122 GTTGGTGGGGGTGCATGCGTGGG + Intergenic
1062578580 9:137219923-137219945 TGGTGTGGGGGTGCCTGTGTGGG - Intergenic
1188769319 X:34132137-34132159 AGTTCTGGGTGTCCATGGGTGGG + Exonic