ID: 1077008671

View in Genome Browser
Species Human (GRCh38)
Location 11:370477-370499
Sequence GTTGTGGGGGTCCATGCGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008671 11 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1077008663_1077008671 10 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1077008664_1077008671 -2 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008671 Original CRISPR GTTGTGGGGGTCCATGCGTA GGG Intronic