ID: 1077008671

View in Genome Browser
Species Human (GRCh38)
Location 11:370477-370499
Sequence GTTGTGGGGGTCCATGCGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008662_1077008671 11 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1077008664_1077008671 -2 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1077008663_1077008671 10 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008671 Original CRISPR GTTGTGGGGGTCCATGCGTA GGG Intronic
901862357 1:12082404-12082426 GGTGTGGGGGTGCATGCCTGTGG + Intronic
903037628 1:20504009-20504031 GGTGTGGTGGTGCATGCCTATGG - Intronic
903411642 1:23148939-23148961 GGTGTGGTGGCACATGCGTATGG + Intronic
904054653 1:27662214-27662236 GATGTGGTGGTCCATGCCTGTGG + Intergenic
904620278 1:31770997-31771019 GTTGTGTGCGTCAATGTGTAGGG + Intergenic
909377723 1:74959218-74959240 GTTGTGGTGGCCCATGCCTGTGG + Intergenic
913671989 1:121105552-121105574 GTTGTGGTGGTACATGCCTGTGG + Intergenic
914662241 1:149800944-149800966 GTTGTGGTGGTACATGCCTGTGG + Intronic
919660030 1:200235429-200235451 GTTGTGGTGGTGCATGCCTGTGG - Intergenic
1063604061 10:7507657-7507679 GGTGTGGTGGTGCATGCGTGTGG + Intergenic
1064433495 10:15290988-15291010 GATGTGGTGGTGCATGCGTGTGG - Intronic
1065004969 10:21371105-21371127 GGTGTGGTGGTGCATGCCTATGG + Intergenic
1067485052 10:46640717-46640739 GGTGTGGTGGTGCATGCCTATGG - Intergenic
1067609704 10:47700940-47700962 GGTGTGGTGGTGCATGCCTATGG + Intergenic
1070614864 10:77961893-77961915 GATGTGGTGGTGCATGCCTATGG - Intergenic
1070639651 10:78158504-78158526 GTTGTGGGTGTCCATCCCTAGGG + Intergenic
1070831044 10:79418305-79418327 GGTGTGGGGGCCCAAGGGTAAGG + Intronic
1071625298 10:87162552-87162574 GGTGTGGTGGTGCATGCCTATGG + Intronic
1072451753 10:95544374-95544396 GATATGGGGGTCCATGGGTTAGG - Intronic
1076482044 10:130791287-130791309 GTGGTGGGGGTCTATACGTGTGG - Intergenic
1077008671 11:370477-370499 GTTGTGGGGGTCCATGCGTAGGG + Intronic
1077207564 11:1352145-1352167 GGGGTGGGGGTCCAGGTGTAAGG - Intergenic
1077207739 11:1352563-1352585 GGGGTGGGGGTCCAGGTGTAAGG - Intergenic
1077355220 11:2113474-2113496 GGTGTGGTGGTGCATGCCTATGG - Intergenic
1079761761 11:24338374-24338396 GTTGTGGTGGTGCATGCCTGTGG - Intergenic
1083551714 11:63594890-63594912 GGGGTGGGGGTACATGGGTAAGG + Intronic
1085581351 11:77653625-77653647 GGTGTGGTGGTGCATGCCTAAGG - Intergenic
1086752083 11:90509150-90509172 CTTGTGGGGTTCCTTGAGTATGG - Intergenic
1087762999 11:102122039-102122061 GGTGTGGTGGTTCATGCCTAAGG - Intronic
1093021091 12:14205087-14205109 GGTGTGGTGGTGCATGCTTATGG - Intergenic
1096701315 12:53384843-53384865 GGTGTGGTGGTACATGCCTATGG + Intronic
1098295845 12:69003498-69003520 GTTGTGGTGGTGCATGCCTGTGG + Intergenic
1099368937 12:81806287-81806309 GTTGTGGGTGTGCATGAGTAGGG + Intergenic
1101246799 12:102891319-102891341 GTTCTGGGGGGTCATGCGCAAGG - Intronic
1104098534 12:125583911-125583933 GTCGTGGGGGTCCAGGAGGATGG + Exonic
1108861989 13:54872175-54872197 GTTGTGGTGGTGCATGCCTGTGG + Intergenic
1110850423 13:80238909-80238931 GTTGTGGGGGTCTATTAGTCAGG + Intergenic
1114438364 14:22726589-22726611 GTTGGGGGGGTCAATGATTAAGG + Intergenic
1117125080 14:52614258-52614280 GGTGTGGTGGTGCATGCCTACGG - Intronic
1117155723 14:52938704-52938726 GGTGTGGTGGTTCATGCCTATGG - Intronic
1119366251 14:74094397-74094419 GTTGTGGTGGTACATGCCTGTGG - Intronic
1122857704 14:104567819-104567841 GTTGTGGGGGCCCATGAGGCCGG + Intronic
1122921140 14:104880717-104880739 GGTGTGGGTGTGCATGAGTAGGG - Intronic
1124457554 15:29858259-29858281 GATGTGGTGGTGCATGCCTATGG + Intronic
1133600906 16:7339577-7339599 GTTGTGGTGGTGCATGCCCACGG - Intronic
1139792955 16:69455335-69455357 GATGTGGGGGTCAATGGGTGTGG - Intronic
1140148670 16:72338851-72338873 GGTGTGGTGGTACATGCCTATGG - Intergenic
1143217969 17:5239348-5239370 GGTGTGGTGGTGCATGCCTATGG - Intergenic
1148020364 17:44549199-44549221 GGTGTGGTGGTGCATGCCTATGG - Intergenic
1152246111 17:79185360-79185382 GTGGTGGGGGTCCCAGCGCAAGG + Intronic
1156634673 18:39012715-39012737 GGTGTGGTGGTGCATGCCTATGG + Intergenic
1161254638 19:3300796-3300818 GGTGTGGTGGTGCATGCCTATGG + Intergenic
1162150649 19:8643087-8643109 GGTGTGGTGGTGCATGCCTATGG - Intergenic
1164739665 19:30566831-30566853 GTAGTGGGGGTCCCTGCATGTGG + Intronic
1165002624 19:32777782-32777804 GTTATGGTGGTGCATGCCTATGG - Intronic
1166389033 19:42398630-42398652 GGTGTGGTGGTGCATGCCTATGG + Intergenic
1168127301 19:54292359-54292381 CATGTGGGGGTCCATGGGAAAGG + Intergenic
930234373 2:48874806-48874828 GTTGTGGTGGTGCATGCCTGTGG - Intergenic
931875039 2:66503253-66503275 GTTGTGGGTGTTCATCCCTAGGG - Intronic
942111200 2:172684280-172684302 GGTGTGGTGGTGCATGCCTATGG + Intergenic
946825585 2:223674241-223674263 GTTGTGGTGGTGCATGCCTGTGG - Intergenic
948093208 2:235313205-235313227 GTTGTGGTGGTGCATGCCTGTGG + Intergenic
1180701211 22:17782267-17782289 GGTGTGGGGGTCCCGGCGTGGGG + Intergenic
1181825147 22:25508976-25508998 GGTGTGGGGGTGCATGCTTGTGG - Intergenic
949173887 3:1035049-1035071 CTTGTGGGGCTCCATGAGTGTGG + Intergenic
963896238 3:150687980-150688002 GTTGTGGTGGTGCATGCCTGTGG + Intronic
964807928 3:160631810-160631832 GTTGTGGGGGCACAGGGGTAGGG + Intergenic
965612297 3:170557236-170557258 ATTATGGGGATCCATTCGTAAGG + Intronic
968166152 3:196466858-196466880 GTTGTGGGGGTGCACGCCTGTGG - Intergenic
968876186 4:3269118-3269140 GTTGTGGAGGTCCATGAGGAGGG + Intronic
968914800 4:3492710-3492732 GTTGTGGGGGTACAGGGGTCTGG - Intronic
970940694 4:21629988-21630010 GCTGTGGTGGTCCATGCCTATGG - Intronic
972329851 4:38054906-38054928 GTTGTGGGGGAGCGTGCGCAGGG + Intronic
973193172 4:47409659-47409681 GCTGTGGGGTTCCATGCTTGAGG + Intronic
974001686 4:56518170-56518192 GGTGTGGTGGTGCATGCCTATGG - Intronic
977557147 4:98497814-98497836 GTTATGGGGGTGCATGGGGAGGG + Intronic
985265170 4:188150266-188150288 GGTGTGGTGGTGCATGCCTATGG - Intergenic
986255956 5:6101564-6101586 GTTGGGGAGGTCCATGCGGTGGG - Intergenic
991413166 5:66365362-66365384 GGTGTGGTGGTGCATGCCTATGG + Intergenic
998795702 5:145816220-145816242 GGTGTGGTGGTGCATGCCTATGG - Intronic
999156784 5:149463930-149463952 GGTGTGGGGGTACATGCCTGTGG - Intergenic
999625964 5:153520550-153520572 TTTGTGGGGGCCCATGGATATGG + Intronic
1015149021 6:130019058-130019080 GGTGTGGGGGGCCGTGCGGAAGG + Intronic
1017874582 6:158514314-158514336 GTTGGGGGGGCGCATGCGTGTGG - Intergenic
1017908529 6:158773183-158773205 GTTGTGGGGGTGCATGGGTGGGG + Intronic
1019304756 7:328002-328024 GTTGTGGGGGACCATGGGGCCGG - Intergenic
1019649749 7:2150435-2150457 GTTTCGGGGGCCCATGGGTAGGG - Intronic
1023901449 7:44483866-44483888 GATGTGGTGGTGCATGCCTATGG + Intronic
1026799362 7:73389496-73389518 GGTGTGGTGGTGCATGCCTATGG - Intergenic
1026814236 7:73497101-73497123 GGTGTGGTGGTGCATGCCTACGG + Intronic
1030426856 7:109388828-109388850 GGTGTGGGGGTACATGCCTGTGG - Intergenic
1030454381 7:109754718-109754740 GTTGTGGTGGTGCATGCCTGTGG - Intergenic
1031483225 7:122302240-122302262 GTTGTGGGTGTGCATGTGGAAGG + Exonic
1032339229 7:131055383-131055405 GGTGTGGTGGTGCATGCCTATGG + Intergenic
1038569951 8:28652512-28652534 GCTGTGGTGGTGCATGCCTATGG + Intronic
1040901370 8:52420082-52420104 GTTGTGGTGGTGCATGCCTGTGG + Intronic
1046655512 8:116889814-116889836 GTTGTGGTGGTGCATGCCTGTGG + Intergenic
1048497365 8:134946373-134946395 GGTGTGGAGGTCCCTGGGTAGGG + Intergenic
1049440522 8:142607383-142607405 GTTGTGGTGGTGCATGCCTGTGG + Intergenic
1049920969 9:363831-363853 GTGGTGGGGGTGCATGGGAATGG + Intronic
1050664014 9:7914652-7914674 GTTGTGGAAGTCCAAGAGTAAGG + Intergenic
1057276720 9:93680101-93680123 TTGGTGGGGGTGCATGCGTGGGG + Intergenic
1057335455 9:94151546-94151568 GGTGAGGGGGTGCATGTGTAGGG + Intergenic
1186487281 X:9943084-9943106 GGTGTGGTGGTGCATGCCTATGG + Intronic
1187864844 X:23714762-23714784 GGTGTGGTGGTGCATGCCTATGG - Intronic
1190854420 X:54279422-54279444 GGTGTGGTGGTGCATGCCTATGG + Intronic
1192439179 X:71162260-71162282 GTTGTGGTGGTGCATGCCTGTGG - Intronic
1194219604 X:91175084-91175106 GTTCTTGGGGTCCATGCCTCTGG - Intergenic
1194953416 X:100153123-100153145 GTTTTGAGAGTCCATGCGGATGG - Intergenic
1196661428 X:118274393-118274415 GGTGTGGGGGCCCATGCCTGTGG + Intergenic
1200556115 Y:4638848-4638870 GTTCTTGGGGTCCATGCCTCTGG - Intergenic