ID: 1077008672

View in Genome Browser
Species Human (GRCh38)
Location 11:370481-370503
Sequence TGGGGGTCCATGCGTAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008663_1077008672 14 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG 0: 1
1: 0
2: 2
3: 10
4: 143
1077008664_1077008672 2 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG 0: 1
1: 0
2: 2
3: 10
4: 143
1077008662_1077008672 15 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG 0: 1
1: 0
2: 2
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008672 Original CRISPR TGGGGGTCCATGCGTAGGGA TGG Intronic
900135514 1:1115617-1115639 AGGGGGTCCCTGGGGAGGGAGGG - Intronic
900525874 1:3128469-3128491 TGCGGAGCCATGCGGAGGGAGGG - Intronic
901055260 1:6446273-6446295 TGGGGGGGCATGCTTGGGGAGGG - Intronic
902391515 1:16109804-16109826 TGGGGATCCAGGTGTAGGGAGGG - Intergenic
902479110 1:16702340-16702362 TGGGGGGGCATGCTTGGGGAGGG + Intergenic
903002914 1:20279124-20279146 TGGAGGTCCAAGAGTGGGGAAGG + Intergenic
903655456 1:24946574-24946596 TGGTGGTCCATGAGTAGGGGGGG - Intronic
904773879 1:32895209-32895231 TGGGGGCCCATACATAGGGGTGG + Intronic
906785827 1:48615088-48615110 TGGGGGTGCAAGTGCAGGGATGG + Intronic
907518898 1:55010544-55010566 TGGGGTTCCCGGCCTAGGGAAGG + Exonic
907518915 1:55010583-55010605 CGGGGGTCCTGGCCTAGGGAAGG + Exonic
910221419 1:84892988-84893010 TGAGGGTCCGGGCGCAGGGAGGG - Intronic
924305725 1:242687223-242687245 TGGGGGACAAGGCGCAGGGAAGG + Intergenic
1062932521 10:1362702-1362724 TGGGTCTCCACGCGTAGGGTCGG - Intronic
1063458470 10:6201460-6201482 TGGGGGTCGAGGCGTGGGGGAGG + Intronic
1065728950 10:28693210-28693232 TGGGGGTCCAGGTGAAGGGCTGG + Intergenic
1066386930 10:34949008-34949030 TGGTGGACCATGCGAAGGGAAGG + Intergenic
1067808679 10:49410371-49410393 TGGGGGCACCTGCGTAGTGATGG + Intergenic
1070647507 10:78211920-78211942 TGGGTCTACATGTGTAGGGATGG + Intergenic
1071897451 10:90082575-90082597 TGGAGCTTCATGTGTAGGGAAGG + Intergenic
1073563203 10:104514447-104514469 TGGGGGTCCAGGGTTGGGGAGGG - Intergenic
1077008672 11:370481-370503 TGGGGGTCCATGCGTAGGGATGG + Intronic
1083879946 11:65543371-65543393 TGGGGGTCCTGGGGTAGGGAGGG + Intronic
1084605061 11:70167635-70167657 TTGGGGACCGTGCCTAGGGACGG - Intronic
1084744008 11:71156021-71156043 TGGGGGTGCATGCGCACAGAGGG + Intronic
1088541902 11:110921717-110921739 TGGGGGGCCGTGGGGAGGGAGGG - Intergenic
1090013135 11:123062471-123062493 TGGGGGCGCATGCGTAGAGGTGG - Intronic
1090988998 11:131799466-131799488 TGTGGGGCCATACGTAGGGTAGG + Intronic
1091276982 11:134359287-134359309 TTGGGTTCCATGAGTGGGGAGGG + Intronic
1091352109 11:134906060-134906082 TGGGGGTCCCTGCGAAGGACAGG + Intergenic
1091910931 12:4230107-4230129 TGGGGGCCCATGTGTCTGGAGGG + Intergenic
1093076708 12:14766391-14766413 TGGGGATTCATGGGAAGGGAGGG + Intergenic
1098877636 12:75883338-75883360 TGGGGGACCTTGCAAAGGGAAGG - Intergenic
1098990482 12:77060110-77060132 TTGGGATCAATGCCTAGGGAAGG - Intronic
1101777328 12:107806490-107806512 TTGGGGTCCCTGCTCAGGGAGGG - Intergenic
1102996025 12:117351305-117351327 TGGGGGTGCTGGCGAAGGGAAGG - Intronic
1104746427 12:131213904-131213926 TGGGGGTGCAGGCGTGGGCAGGG + Intergenic
1106099616 13:26682870-26682892 TGGGGGGCCATGCATTGGGGAGG - Exonic
1111229483 13:85325022-85325044 TAGGTGTTCATGCCTAGGGAAGG + Intergenic
1113619166 13:111701334-111701356 TGGGGGTCCCTGAGGACGGAAGG + Intergenic
1113624695 13:111786595-111786617 TGGGGGTCCCTGAGGACGGAAGG + Intergenic
1114658632 14:24330981-24331003 TGAGGGTCCCTGGGTGGGGAGGG + Intronic
1119422648 14:74516749-74516771 TGGTGGGCAGTGCGTAGGGAGGG + Intronic
1122791504 14:104185820-104185842 TGGGGGTACAGGTGAAGGGATGG + Intergenic
1128211875 15:65908947-65908969 TGGGGGTCAAGGTGCAGGGATGG + Intronic
1132684486 16:1156611-1156633 TGCGGGGCCCTGCGGAGGGAGGG - Intronic
1133307473 16:4819707-4819729 TAGGGGTCCATTTGTAGAGATGG - Intronic
1135841019 16:25876319-25876341 TGAAGGTCCATGGGTAGGTATGG + Intronic
1139303288 16:65963002-65963024 TGGGGGTCCCTGAGTGAGGAAGG - Intergenic
1140481087 16:75263277-75263299 TGGGAGTCCATGTTTAGGGGTGG - Intronic
1142000485 16:87661502-87661524 TGGGGGTCCAGGACTGGGGAGGG + Intronic
1143352297 17:6297773-6297795 TGGGGGCCAATGCCTATGGAAGG - Intergenic
1145978617 17:28998413-28998435 TGGGGACCCAGGGGTAGGGAGGG + Intronic
1146453206 17:32990994-32991016 TGGTGGTGCATGTGCAGGGATGG - Intronic
1147215342 17:38896036-38896058 TGGGGGTCCCTGTGGAGGAAGGG - Intronic
1147769912 17:42860342-42860364 TGGGGCTCCATGAGTAGGTAGGG - Intergenic
1149536085 17:57434547-57434569 TGGGGGTGCATGGGGAAGGAGGG - Intronic
1149992272 17:61389839-61389861 TGGGGGCCTATGCCAAGGGACGG + Intronic
1152636054 17:81430976-81430998 TGGGGGTCCCGGCGTGGGGGTGG + Intronic
1152636082 17:81431044-81431066 TGGGGGTCCCGGCGTGGGGGTGG + Intronic
1153734154 18:8046837-8046859 TGGAGGTCCAGGAGTATGGATGG - Intronic
1156474578 18:37397541-37397563 GGGGAGTCCATGGGTGGGGAGGG + Intronic
1157571076 18:48712770-48712792 AGGGTGTGCATGCGTAGGGAAGG - Intronic
1157700986 18:49761550-49761572 TGGGGGTGCATGTGGGGGGATGG - Intergenic
1158887366 18:61840881-61840903 TGTGGTTTCATGGGTAGGGAAGG - Intronic
1160115222 18:76073014-76073036 TGGGGGTACATGTGAAGAGAAGG - Intergenic
1161647391 19:5461942-5461964 TGGGGAGCCAGGCGTGGGGAAGG - Intergenic
1161998572 19:7729708-7729730 TGGGGCTCCATACTTAGGGATGG - Intronic
1162007654 19:7790262-7790284 TGGGGCTCCATGCTTAGGGATGG + Intergenic
1162777806 19:12990323-12990345 TGGGGGTCCAGGTGTAGGGAGGG - Intergenic
1164818794 19:31227956-31227978 TGGGGGTCCGTGTGGATGGAGGG - Intergenic
1166390824 19:42407886-42407908 TGGGGCTCCAGGCCCAGGGATGG - Intronic
1168127302 19:54292363-54292385 TGGGGGTCCATGGGAAAGGCTGG + Intergenic
1202713151 1_KI270714v1_random:28247-28269 TGGGGGGGCATGCTTGGGGAGGG + Intergenic
925363117 2:3293379-3293401 TGTGAGTCCATGCGTGGGGAGGG + Intronic
937233748 2:120418055-120418077 TGGGGTTCCATGAAGAGGGAGGG + Intergenic
938141629 2:128799324-128799346 GAGGTGTCCATGAGTAGGGAGGG + Intergenic
939101369 2:137898013-137898035 TGTGGGTCCATGCTTGGGGGTGG + Intergenic
947724307 2:232387767-232387789 TGCGGGTCCCTGGGTTGGGAGGG + Intergenic
948175787 2:235941799-235941821 GTGGGATCCATGCGAAGGGAAGG + Intronic
948445424 2:238029186-238029208 GGGGGGCCCATGCTCAGGGAAGG - Intronic
949065568 2:241988241-241988263 CTGGGGTCCATGCGTGGAGAGGG + Intergenic
1170050000 20:12131821-12131843 TGGGGGTACATACGTAGGAGTGG - Intergenic
1174568638 20:51485243-51485265 TGGGGGACCATGAGTAGAGGGGG - Intronic
1176236308 20:64055377-64055399 TGGGGTGCCAGGTGTAGGGAGGG + Intronic
1176310177 21:5145204-5145226 TTGGGGTCCCTGGGTGGGGAAGG - Intronic
1179846879 21:44116832-44116854 TTGGGGTCCCTGGGTGGGGAAGG + Intronic
1183639395 22:39083918-39083940 TGGGTGTCCCTGGGTTGGGAGGG - Intronic
1184048701 22:41988608-41988630 AGGGGGTCGAAGCCTAGGGAGGG - Intronic
951738158 3:25890856-25890878 GGGGAGGCCATGGGTAGGGAAGG + Intergenic
951871397 3:27366578-27366600 TGGGGCTCCATGCCCAGTGAGGG - Intronic
952855670 3:37768953-37768975 TGGGGTTCCAAGGATAGGGAGGG - Intronic
961381500 3:126498921-126498943 TGGGGGTGCAGGTCTAGGGAAGG - Intronic
961486556 3:127221338-127221360 TGGAGGTCCATTCTGAGGGAGGG + Intergenic
961521023 3:127467417-127467439 TGGGGGTCCCTGGCCAGGGAGGG + Intergenic
961645943 3:128392856-128392878 TGGGGCACCATGAGCAGGGAAGG + Intronic
968467086 4:758218-758240 TGGGGGTGCTTGTGCAGGGAGGG - Intronic
968521714 4:1037276-1037298 TGAGGGTCCCTGCCCAGGGAGGG + Intergenic
968524113 4:1047238-1047260 TGGAGGTCCATGCGGAGGCGCGG + Intergenic
968876187 4:3269122-3269144 TGGAGGTCCATGAGGAGGGCAGG + Intronic
972400951 4:38703109-38703131 TGGGGGTCCATGCATACCGACGG + Intergenic
975089976 4:70389958-70389980 TTGGGGTGCAGGAGTAGGGAGGG - Exonic
979639403 4:122996256-122996278 TTGGAGTCCATGTGTATGGAAGG - Intronic
985231489 4:187822701-187822723 TGGGGGTTCATGGATAGTGAGGG - Intergenic
986311813 5:6556829-6556851 TGGGTGTCCATTTGTAAGGAAGG + Intergenic
990646348 5:57848850-57848872 TTGGGGTCCATGCTTATGAATGG + Intergenic
997661128 5:135590368-135590390 CGGGGGCCCATGGGCAGGGATGG - Intergenic
998254796 5:140576450-140576472 TGGGGGTTCCTGGTTAGGGAGGG + Intronic
999316795 5:150589458-150589480 TCAAGGTCCATTCGTAGGGATGG - Intergenic
1001419407 5:171574973-171574995 TGGGGTTCCTGGCTTAGGGATGG + Intergenic
1004692440 6:18004059-18004081 TGGGGGTGGATGGGGAGGGAGGG - Intergenic
1006185673 6:32180390-32180412 AGGGGGTCCAGGAGTACGGAAGG - Exonic
1006295191 6:33167115-33167137 TGGGGGTCCCTGTGGAGAGATGG + Exonic
1007269779 6:40627726-40627748 TGTGGGGCCATGAGGAGGGAGGG - Intergenic
1009040458 6:58170124-58170146 TGGAGGTCCCTGAGTAGGTAGGG - Intergenic
1009571771 6:65394394-65394416 TGGAGGTTCATGAGTAGAGAAGG - Intronic
1019329605 7:455967-455989 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019329701 7:456210-456232 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019329987 7:456951-456973 TGGGGGTCCTGGCGTTGGGGTGG - Intergenic
1019330043 7:457094-457116 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019330130 7:457295-457317 TGGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019330173 7:457396-457418 TGGGGGTCCTGGCATTGGGATGG - Intergenic
1019330228 7:457526-457548 TGGGGGTCCTGGCATTGGGATGG - Intergenic
1021217233 7:17931971-17931993 TGGGGGTCCATTTTTAAGGAGGG - Intronic
1022317882 7:29262778-29262800 TGGGGGTGCAGGGGGAGGGAGGG + Intronic
1022983922 7:35630473-35630495 TTTGGGTCCATGATTAGGGATGG - Intergenic
1023390941 7:39711139-39711161 TGGTGGTTCATGCCTATGGAGGG + Intergenic
1026469204 7:70680562-70680584 TGGGGGTGCATGAGGAGGCATGG - Intronic
1026933397 7:74237843-74237865 TGGGGGACCTTTTGTAGGGAAGG - Intronic
1027164290 7:75823546-75823568 TGGGGGCCCATGTGCAGGGTGGG + Intergenic
1029494758 7:100890779-100890801 TGGGGGTCCCTGAGAAGGGTGGG + Exonic
1030740926 7:113109077-113109099 TGGGGGTGAATGGGAAGGGAGGG + Intergenic
1034905255 7:154939052-154939074 TGGGGTTCCAGTCTTAGGGAAGG + Intronic
1035582290 8:747755-747777 TGGGGGTCTCTGCGGTGGGATGG + Intergenic
1039572739 8:38600575-38600597 AGGGGGTCCAGGAGTACGGAAGG + Intergenic
1040477071 8:47788197-47788219 TGGAGATCCCTGCGTGGGGAGGG + Intronic
1047177557 8:122555846-122555868 TGGTGGTCCCTGCCTTGGGAAGG + Intergenic
1048979307 8:139694602-139694624 TGGCTGGCCATGCGTAGGGTAGG + Intronic
1049493674 8:142918079-142918101 TGGGGGTCCATGCTGGTGGAAGG + Intergenic
1049572929 8:143378067-143378089 TGGGGGCCAATGTGTATGGAGGG - Intronic
1049684026 8:143932106-143932128 TGGGGCTCCCTGGGTAGGGGCGG - Intronic
1050377335 9:4986073-4986095 TGGGAGTGCGTGCGTAGGGAAGG + Intronic
1050928627 9:11297431-11297453 TGGGGGTCCATGCTGAGCGCAGG + Intergenic
1051053410 9:12956203-12956225 TAGGGGTCCTTGAGTGGGGATGG - Intergenic
1051184220 9:14441784-14441806 TGGGTGTCTATGGCTAGGGATGG - Intergenic
1052857430 9:33415954-33415976 TCGGGGCCCATGGGCAGGGATGG + Intergenic
1056731062 9:89167105-89167127 TGGGGGTCCAGCAGGAGGGAGGG + Intronic
1057335459 9:94151550-94151572 AGGGGGTGCATGTGTAGGGGGGG + Intergenic
1061926037 9:133806521-133806543 TGGGGGTCCCGGGGTGGGGATGG - Intronic
1186891338 X:13961911-13961933 TGGGGGTCAATTTGTAGAGAGGG + Intergenic
1189336302 X:40172675-40172697 TGGGGCTCCATGCCTCGGGCTGG + Intronic
1192243919 X:69357911-69357933 TGGGGGCCCATGGGGAGGGGAGG - Intergenic
1194399552 X:93426402-93426424 GGGGGGTCCAGGACTAGGGAAGG + Intergenic
1194900867 X:99510153-99510175 TTGGGGGGCATGCGGAGGGAGGG - Intergenic
1197198432 X:123727027-123727049 TGCGGGTGTATGAGTAGGGATGG - Intronic
1201424163 Y:13831098-13831120 TGGGGGTCCAGGGGAAGGGTGGG + Intergenic