ID: 1077008673

View in Genome Browser
Species Human (GRCh38)
Location 11:370482-370504
Sequence GGGGGTCCATGCGTAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077008663_1077008673 15 Left 1077008663 11:370444-370466 CCGGCGGGGGCGCCTTCGGTGAA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1077008664_1077008673 3 Left 1077008664 11:370456-370478 CCTTCGGTGAACTGTGCCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1077008662_1077008673 16 Left 1077008662 11:370443-370465 CCCGGCGGGGGCGCCTTCGGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077008673 Original CRISPR GGGGGTCCATGCGTAGGGAT GGG Intronic
900135513 1:1115616-1115638 GGGGGTCCCTGGGGAGGGAGGGG - Intronic
901475241 1:9485016-9485038 GGGGGTCCATGCAGAGGGGCAGG - Intergenic
904773880 1:32895210-32895232 GGGGGCCCATACATAGGGGTGGG + Intronic
906785828 1:48615089-48615111 GGGGGTGCAAGTGCAGGGATGGG + Intronic
914225924 1:145719582-145719604 TGGGGTCCAGGTGAAGGGATGGG + Intronic
1067808680 10:49410372-49410394 GGGGGCACCTGCGTAGTGATGGG + Intergenic
1070647508 10:78211921-78211943 GGGTCTACATGTGTAGGGATGGG + Intergenic
1070768439 10:79069337-79069359 CGGGGTGCAAGCGTGGGGATTGG + Intronic
1070815398 10:79319624-79319646 AGGGGTGCATGTGTGGGGATAGG - Intergenic
1071660813 10:87500780-87500802 AGGGGTCCATGTGTACAGATAGG - Intergenic
1071797167 10:89019290-89019312 GGGGTTCCCTGCCTAGGGACTGG - Intergenic
1073796870 10:106997904-106997926 GGAGGTGCATGGGTAGGGAGAGG + Intronic
1077008673 11:370482-370504 GGGGGTCCATGCGTAGGGATGGG + Intronic
1077807060 11:5601077-5601099 GGGGGTCCATATGTAAGGAGAGG - Intronic
1081632805 11:44701182-44701204 GGGGCTCCAGGTGTAGGGCTGGG - Intergenic
1084883572 11:72189139-72189161 GGGGGTCCATGAGTTGGGGATGG + Intergenic
1089009698 11:115122435-115122457 GGAGGTGCATGCTCAGGGATGGG + Intergenic
1093101950 12:15038332-15038354 GTGGGTGCATGGGTAGGCATTGG + Intergenic
1104903317 12:132200832-132200854 GGAGGTCCATGTGAAGGAATGGG + Intronic
1107629981 13:42333588-42333610 GGGGGTCCAGACGTGGGAATAGG - Intergenic
1111685758 13:91499011-91499033 GGTGATCCATGATTAGGGATGGG + Intronic
1113156790 13:107332507-107332529 GAGGGGCCATGCGTAGAGACTGG - Intronic
1121006866 14:90496222-90496244 GGGGGTCCAGGAGTTTGGATTGG - Intergenic
1122791505 14:104185821-104185843 GGGGGTACAGGTGAAGGGATGGG + Intergenic
1122922475 14:104885682-104885704 GGGCTTCCATGAGGAGGGATCGG + Intronic
1128211876 15:65908948-65908970 GGGGGTCAAGGTGCAGGGATGGG + Intronic
1133001954 16:2856312-2856334 TGGGGTGCAGGCCTAGGGATTGG - Intronic
1134891452 16:17845071-17845093 GGGGGTCCTTGAGTCTGGATAGG - Intergenic
1141119079 16:81336847-81336869 GGCTGTGCATGGGTAGGGATGGG - Intronic
1141315943 16:82962529-82962551 TGGGGTCCATGAGAAGGGATAGG + Intronic
1142794129 17:2293966-2293988 GGGGGCACATGCCTTGGGATTGG - Intronic
1144017512 17:11210027-11210049 GAGGGACCATGTGTAGGGAGAGG - Intergenic
1147767656 17:42847603-42847625 AGGGGACCATGGGAAGGGATTGG + Intronic
1147769911 17:42860341-42860363 GGGGCTCCATGAGTAGGTAGGGG - Intergenic
1149920431 17:60653652-60653674 GGTAGTCCATGCTTATGGATTGG - Intronic
1153734153 18:8046836-8046858 GGAGGTCCAGGAGTATGGATGGG - Intronic
1156178318 18:34573837-34573859 GGGGCTGGATGGGTAGGGATTGG - Intronic
1156464362 18:37339382-37339404 GTGGGTCCATGCAGATGGATAGG + Intronic
1157700985 18:49761549-49761571 GGGGGTGCATGTGGGGGGATGGG - Intergenic
1160149176 18:76386184-76386206 GGGGGCCCTTGCTTGGGGATTGG + Intronic
1161112266 19:2477002-2477024 GGGGGCCAAAGGGTAGGGATGGG - Intronic
1161998571 19:7729707-7729729 GGGGCTCCATACTTAGGGATGGG - Intronic
1162007655 19:7790263-7790285 GGGGCTCCATGCTTAGGGATGGG + Intergenic
1162777805 19:12990322-12990344 GGGGGTCCAGGTGTAGGGAGGGG - Intergenic
1163034627 19:14563680-14563702 TGGGGTCCAGGCGGAGGGACTGG - Exonic
1163493081 19:17628189-17628211 GGGGGTCCATGAGAGGGGCTGGG + Intronic
1166687950 19:44807430-44807452 GGGGGTCCCTGGCTGGGGATAGG - Intergenic
1166869999 19:45865207-45865229 GGAGGGTCATGGGTAGGGATGGG - Intronic
926780878 2:16470791-16470813 GGCTGTGCATGTGTAGGGATGGG + Intergenic
932770713 2:74499459-74499481 GGGGGACCATGCGCGGGGCTAGG + Exonic
945008412 2:205435028-205435050 GGGGGTACATGTGCAGGTATGGG - Intronic
946933452 2:224695088-224695110 GGGGGAGCATGTGTAGGGATTGG + Intergenic
948175788 2:235941800-235941822 TGGGATCCATGCGAAGGGAAGGG + Intronic
948620283 2:239230243-239230265 GGGGGTCCATTCATTGGGTTGGG + Intronic
1175790501 20:61737450-61737472 GGGGGTCCCTGGGGTGGGATGGG - Intronic
1178522067 21:33294729-33294751 GGGGTTCCATCTGTAGGGAAAGG + Intronic
1183478696 22:38051000-38051022 GGGGGCCCATTGGTGGGGATGGG - Intergenic
954108837 3:48423214-48423236 GGGGGTTCTTGGGTAGGGACAGG - Intronic
954657893 3:52208175-52208197 GGGGCTCGAGGCGGAGGGATTGG + Exonic
963454099 3:145522072-145522094 GGGGGTCCATTCATATGGCTGGG + Intergenic
963498946 3:146100711-146100733 GGGTGTGCATGTGTAGGGTTGGG + Intronic
968068151 3:195770411-195770433 GGGGGCCCATGTGTAGGAGTGGG - Intronic
974416692 4:61617102-61617124 AGGGGTCCCTTCGTAGGCATAGG + Intronic
979765906 4:124463628-124463650 TGGGGTCCAGGCGGAGGGACTGG + Intergenic
985525477 5:399225-399247 GGGGTCCCAGGCTTAGGGATCGG + Intronic
992319362 5:75595811-75595833 GGGTGTGCATGTGTAGGGAAAGG + Intronic
999024191 5:148207434-148207456 GGGGGTCCCTGCGTAGTACTTGG + Intronic
999316794 5:150589457-150589479 CAAGGTCCATTCGTAGGGATGGG - Intergenic
1004251336 6:14025446-14025468 GGCGGTCTATGCGAAGGGGTTGG - Intergenic
1006185672 6:32180389-32180411 GGGGGTCCAGGAGTACGGAAGGG - Exonic
1006286642 6:33101088-33101110 GGGGGTCTATGAATAGGGAATGG + Intergenic
1006295192 6:33167116-33167138 GGGGGTCCCTGTGGAGAGATGGG + Exonic
1007368972 6:41413733-41413755 GGGAGTCCATGCCTATTGATGGG - Intergenic
1008977655 6:57446713-57446735 GGAGGTCCCTGTGTAAGGATTGG + Intronic
1009165793 6:60339660-60339682 GGAGGTCCCTGTGTAAGGATTGG + Intergenic
1012898132 6:104975426-104975448 TGGGGTCTATGCCTAGGGATTGG - Intronic
1019329604 7:455966-455988 GGGGGTCCCGGCGTTGGGGTGGG - Intergenic
1019329700 7:456209-456231 GGGGGTCCCGGCGTTGGGGTGGG - Intergenic
1019329986 7:456950-456972 GGGGGTCCTGGCGTTGGGGTGGG - Intergenic
1019330042 7:457093-457115 GGGGGTCCCGGCGTTGGGGTGGG - Intergenic
1019330072 7:457165-457187 GGGGGTCCTGGCGTTGGGGTGGG - Intergenic
1019330129 7:457294-457316 GGGGGTCCCGGCGTTGGGGTGGG - Intergenic
1019330172 7:457395-457417 GGGGGTCCTGGCATTGGGATGGG - Intergenic
1019330227 7:457525-457547 GGGGGTCCTGGCATTGGGATGGG - Intergenic
1019626597 7:2019032-2019054 GTGGCTCCATGCGTCGGGAGAGG - Intronic
1019893065 7:3962642-3962664 GGGGACCCCTGCGTAGGAATGGG - Exonic
1025235882 7:57234682-57234704 GAGGGTCCCTGCCTAGAGATAGG + Intergenic
1033741070 7:144276310-144276332 GGGAGTTCATGGGCAGGGATGGG + Intergenic
1033752836 7:144373304-144373326 GGGAGTTCATGGGCAGGGATGGG - Intronic
1035582291 8:747756-747778 GGGGGTCTCTGCGGTGGGATGGG + Intergenic
1039572740 8:38600576-38600598 GGGGGTCCAGGAGTACGGAAGGG + Intergenic
1041246786 8:55895901-55895923 GGGGTACCATGAGTAGGGAGTGG - Intronic
1042596072 8:70449619-70449641 GGGGATCCCTGGGTAGAGATTGG - Intergenic
1044575345 8:93762645-93762667 GGGGGTGTATTCTTAGGGATGGG + Intronic
1045337941 8:101224782-101224804 CGGGGTCCAGGAGTAGGGGTTGG - Intergenic
1048063330 8:130943217-130943239 CAGGGTCCATGCCTAGGGACAGG + Intronic
1051053409 9:12956202-12956224 AGGGGTCCTTGAGTGGGGATGGG - Intergenic
1052857431 9:33415955-33415977 CGGGGCCCATGGGCAGGGATGGG + Intergenic
1056810595 9:89760853-89760875 GGGTGTCCCTGAGTAGGGTTTGG - Intergenic
1057274932 9:93671108-93671130 GGGGGTGCATGTGTGGGGGTAGG + Intronic
1060909746 9:127340112-127340134 GTGGGTATATGCTTAGGGATAGG + Intronic
1061509657 9:131052783-131052805 GGGGTACCATGCCTGGGGATGGG - Intronic
1061926036 9:133806520-133806542 GGGGGTCCCGGGGTGGGGATGGG - Intronic
1186220439 X:7344118-7344140 GAGGGTTCATGTGTAGGGAGTGG + Intronic
1194399553 X:93426403-93426425 GGGGGTCCAGGACTAGGGAAGGG + Intergenic
1197198431 X:123727026-123727048 GCGGGTGTATGAGTAGGGATGGG - Intronic
1202343690 Y:23897100-23897122 GGTGGTCCATGCTTATGGATTGG - Intergenic
1202527078 Y:25772985-25773007 GGTGGTCCATGCTTATGGATTGG + Intergenic